EMAIL THIS PAGE TO A FRIEND

PVR

poliovirus receptor

72 Gene Product Result for
Synonyms: CD155 HVED NECL5 Necl-5 PVS TAGE4
UniProtKB ID: P15151, B4DTS9, P15152, Q15267, Q15268, Q96BJ1
Gene ID:
Human(5817) Summary: The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(52118) poliovirus receptor
Rat(25066) poliovirus receptor
fruit fly(34127) PDGF- and VEGF-receptor related
domestic cat(101096773) poliovirus receptor
dog(476439) poliovirus receptor
cow(526865) poliovirus receptor
sheep(101110963) poliovirus receptor
domestic guinea pig(101788294) poliovirus receptor
Domestic Rabbit(100328928) poliovirus receptor
naked mole-rat(101712173) poliovirus receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1323 Human CD155 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006505 Rosetta Predictions human pricing
NM_017076 Rosetta Predictions rat pricing
NM_027514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341714 predicted 1353
2 SASI_Hs01_00062492 predicted 897
3 SASI_Hs02_00341715 predicted 414
4 SASI_Hs02_00341716 predicted 775
5 SASI_Hs01_00062493 predicted 1283
6 SASI_Hs01_00062494 predicted 798
7 SASI_Hs01_00062495 predicted 1170
8 SASI_Hs01_00062496 predicted 996
9 SASI_Hs01_00062497 predicted 502
10 SASI_Hs01_00062498 predicted 328
11 SASI_Hs01_00062499 predicted 835
12 SASI_Hs01_00062500 predicted 1191
13 SASI_Hs01_00062501 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030908 predicted 856
2 SASI_Rn01_00030909 predicted 836
3 SASI_Rn01_00030910 predicted 1094
4 SASI_Rn01_00030911 predicted 1118
5 SASI_Rn01_00030912 predicted 1067
6 SASI_Rn01_00030913 predicted 615
7 SASI_Rn01_00030914 predicted 1080
8 SASI_Rn01_00030915 predicted 405
9 SASI_Rn02_00261286 predicted 889
10 SASI_Rn01_00030916 predicted 1346
11 SASI_Rn01_00030917 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085341 predicted 1055
2 SASI_Mm01_00085342 predicted 928
3 SASI_Mm01_00085343 predicted 560
4 SASI_Mm02_00332348 predicted 412
5 SASI_Mm01_00085344 predicted 588
6 SASI_Mm01_00085345 predicted 945
7 SASI_Mm01_00085347 predicted 234
8 SASI_Mm01_00085348 predicted 819
9 SASI_Mm01_00085350 predicted 1167
10 SASI_Mm02_00332349 predicted 544
11 SASI_Mm01_00085346 predicted 618
12 SASI_Mm01_00085349 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027514
VALIDATED
PVR MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1236s1c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-1344s21c1
Sequence:CCGGTGGAACCCTACTCTCATAAATCTCGAGATTTATGAGAGTAGGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-957s1c1
Sequence:CCGGCCAGGGCAATATGCTTCTAATCTCGAGATTAGAAGCATATTGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-216s1c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1153s1c1
Sequence:CCGGGTCATCATCATCGCAGCACTACTCGAGTAGTGCTGCGATGATGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-2068s1c1
Sequence:CCGGCCCAGACACTATTCTGACTTACTCGAGTAAGTCAGAATAGTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.2-379s21c1
Sequence:CCGGAGAGCCAGAGAGGGTGAAATTCTCGAGAATTTCACCCTCTCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-894s21c1
Sequence:CCGGGCCTGACATGGCTGGATATAACTCGAGTTATATCCAGCCATGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-216s21c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-621s21c1
Sequence:CCGGGAATGGAAGTCACCGTGAAATCTCGAGATTTCACGGTGACTTCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-1236s21c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027514.2-1579s21c1
Sequence:CCGGTGAGTCTAGCTTGGGCTATAGCTCGAGCTATAGCCCAAGCTAGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027514
VALIDATED
PVR MISSION shRNA shRNA Plasmid DNA
poliovirus receptor
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1236s1c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-1344s21c1
Sequence:CCGGTGGAACCCTACTCTCATAAATCTCGAGATTTATGAGAGTAGGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-957s1c1
Sequence:CCGGCCAGGGCAATATGCTTCTAATCTCGAGATTAGAAGCATATTGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-216s1c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1153s1c1
Sequence:CCGGGTCATCATCATCGCAGCACTACTCGAGTAGTGCTGCGATGATGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-2068s1c1
Sequence:CCGGCCCAGACACTATTCTGACTTACTCGAGTAAGTCAGAATAGTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.2-379s21c1
Sequence:CCGGAGAGCCAGAGAGGGTGAAATTCTCGAGAATTTCACCCTCTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-894s21c1
Sequence:CCGGGCCTGACATGGCTGGATATAACTCGAGTTATATCCAGCCATGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-216s21c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-621s21c1
Sequence:CCGGGAATGGAAGTCACCGTGAAATCTCGAGATTTCACGGTGACTTCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-1236s21c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027514.2-1579s21c1
Sequence:CCGGTGAGTCTAGCTTGGGCTATAGCTCGAGCTATAGCCCAAGCTAGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027514
VALIDATED
PVR MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1236s1c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-1344s21c1
Sequence:CCGGTGGAACCCTACTCTCATAAATCTCGAGATTTATGAGAGTAGGGTTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-957s1c1
Sequence:CCGGCCAGGGCAATATGCTTCTAATCTCGAGATTAGAAGCATATTGCCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-216s1c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-1153s1c1
Sequence:CCGGGTCATCATCATCGCAGCACTACTCGAGTAGTGCTGCGATGATGATGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027514.1-2068s1c1
Sequence:CCGGCCCAGACACTATTCTGACTTACTCGAGTAAGTCAGAATAGTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.2-379s21c1
Sequence:CCGGAGAGCCAGAGAGGGTGAAATTCTCGAGAATTTCACCCTCTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027514.1-894s21c1
Sequence:CCGGGCCTGACATGGCTGGATATAACTCGAGTTATATCCAGCCATGTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-216s21c1
Sequence:CCGGGCACTGTAGTCTGACTTCTAACTCGAGTTAGAAGTCAGACTACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-621s21c1
Sequence:CCGGGAATGGAAGTCACCGTGAAATCTCGAGATTTCACGGTGACTTCCATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027514.1-1236s21c1
Sequence:CCGGCGTCCAGTATTCATCTGTGAACTCGAGTTCACAGATGAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027514.2-1579s21c1
Sequence:CCGGTGAGTCTAGCTTGGGCTATAGCTCGAGCTATAGCCCAAGCTAGACTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006505
PVR MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-1346s1c1
Sequence:CCGGCTAATGGGCATGTCTCCTATTCTCGAGAATAGGAGACATGCCCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-904s1c1
Sequence:CCGGGAGGTATCCATCTCTGGCTATCTCGAGATAGCCAGAGATGGATACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-816s1c1
Sequence:CCGGCGGCAAGAATGTGACCTGCAACTCGAGTTGCAGGTCACATTCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-986s1c1
Sequence:CCGGCAGAGCCCACAGGCTATAATTCTCGAGAATTATAGCCTGTGGGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-421s1c1
Sequence:CCGGCCCAGCTATTCGGAGTCCAAACTCGAGTTTGGACTCCGAATAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1884s21c1
Sequence:CCGGTCTCCCAGTGGAGCCATATAGCTCGAGCTATATGGCTCCACTGGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1771s21c1
Sequence:CCGGTAGGCTCACAGTTACAGTTTACTCGAGTAAACTGTAACTGTGAGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006505.3-1378s21c1
Sequence:CCGGGGATCGGGATTTATTTCTATTCTCGAGAATAGAAATAAATCCCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006505
PVR MISSION shRNA shRNA Plasmid DNA
poliovirus receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-1346s1c1
Sequence:CCGGCTAATGGGCATGTCTCCTATTCTCGAGAATAGGAGACATGCCCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-904s1c1
Sequence:CCGGGAGGTATCCATCTCTGGCTATCTCGAGATAGCCAGAGATGGATACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-816s1c1
Sequence:CCGGCGGCAAGAATGTGACCTGCAACTCGAGTTGCAGGTCACATTCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-986s1c1
Sequence:CCGGCAGAGCCCACAGGCTATAATTCTCGAGAATTATAGCCTGTGGGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-421s1c1
Sequence:CCGGCCCAGCTATTCGGAGTCCAAACTCGAGTTTGGACTCCGAATAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1884s21c1
Sequence:CCGGTCTCCCAGTGGAGCCATATAGCTCGAGCTATATGGCTCCACTGGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1771s21c1
Sequence:CCGGTAGGCTCACAGTTACAGTTTACTCGAGTAAACTGTAACTGTGAGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006505.3-1378s21c1
Sequence:CCGGGGATCGGGATTTATTTCTATTCTCGAGAATAGAAATAAATCCCGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006505
PVR MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-1346s1c1
Sequence:CCGGCTAATGGGCATGTCTCCTATTCTCGAGAATAGGAGACATGCCCATTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-904s1c1
Sequence:CCGGGAGGTATCCATCTCTGGCTATCTCGAGATAGCCAGAGATGGATACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-816s1c1
Sequence:CCGGCGGCAAGAATGTGACCTGCAACTCGAGTTGCAGGTCACATTCTTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-986s1c1
Sequence:CCGGCAGAGCCCACAGGCTATAATTCTCGAGAATTATAGCCTGTGGGCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006505.2-421s1c1
Sequence:CCGGCCCAGCTATTCGGAGTCCAAACTCGAGTTTGGACTCCGAATAGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1884s21c1
Sequence:CCGGTCTCCCAGTGGAGCCATATAGCTCGAGCTATATGGCTCCACTGGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006505.3-1771s21c1
Sequence:CCGGTAGGCTCACAGTTACAGTTTACTCGAGTAAACTGTAACTGTGAGCCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006505.3-1378s21c1
Sequence:CCGGGGATCGGGATTTATTTCTATTCTCGAGAATAGAAATAAATCCCGATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)