EMAIL THIS PAGE TO A FRIEND

PVRIG

poliovirus receptor related immunoglobulin domain containing

17 Gene Product Result for
Synonyms: C7orf15
UniProtKB ID: Q6DKI7, D6W5U9, Q9BVK3
Gene ID:
domestic guinea pig(100716261) poliovirus receptor related immunoglobulin domain containing
cow(514026) poliovirus receptor related immunoglobulin domain containing
sheep(101122405) poliovirus receptor related immunoglobulin domain containing
dog(608526) poliovirus receptor related immunoglobulin domain containing
domestic cat(101099421) poliovirus receptor related immunoglobulin domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024070 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223403 predicted 622
2 SASI_Hs01_00223404 predicted 444
3 SASI_Hs01_00223405 predicted 918
4 SASI_Hs01_00223406 predicted 476
5 SASI_Hs01_00223408 predicted 898
6 SASI_Hs01_00223407 predicted 892
7 SASI_Hs01_00223409 predicted 1519
8 SASI_Hs01_00223410 predicted 1246
9 SASI_Hs01_00223411 predicted 1402
10 SASI_Hs01_00223412 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024070
PVRIG MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor related immunoglobulin domain containing
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1389s1c1
Sequence:CCGGCTTACTTTAATTCTTGGGCCTCTCGAGAGGCCCAAGAATTAAAGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1407s1c1
Sequence:CCGGCCTCCAATAAGTGTCCCATAGCTCGAGCTATGGGACACTTATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1199s1c1
Sequence:CCGGGCAGCTTTGTCTCTGTTGAGACTCGAGTCTCAACAGAGACAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1200s1c1
Sequence:CCGGCAGCTTTGTCTCTGTTGAGAACTCGAGTTCTCAACAGAGACAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024070
PVRIG MISSION shRNA shRNA Plasmid DNA
poliovirus receptor related immunoglobulin domain containing
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1389s1c1
Sequence:CCGGCTTACTTTAATTCTTGGGCCTCTCGAGAGGCCCAAGAATTAAAGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1407s1c1
Sequence:CCGGCCTCCAATAAGTGTCCCATAGCTCGAGCTATGGGACACTTATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1199s1c1
Sequence:CCGGGCAGCTTTGTCTCTGTTGAGACTCGAGTCTCAACAGAGACAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1200s1c1
Sequence:CCGGCAGCTTTGTCTCTGTTGAGAACTCGAGTTCTCAACAGAGACAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024070
PVRIG MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor related immunoglobulin domain containing
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1389s1c1
Sequence:CCGGCTTACTTTAATTCTTGGGCCTCTCGAGAGGCCCAAGAATTAAAGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024070.3-1407s1c1
Sequence:CCGGCCTCCAATAAGTGTCCCATAGCTCGAGCTATGGGACACTTATTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1199s1c1
Sequence:CCGGGCAGCTTTGTCTCTGTTGAGACTCGAGTCTCAACAGAGACAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024070.3-1200s1c1
Sequence:CCGGCAGCTTTGTCTCTGTTGAGAACTCGAGTTCTCAACAGAGACAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)