EMAIL THIS PAGE TO A FRIEND

PVRL1

poliovirus receptor-related 1 (herpesvirus entry mediator C)

221 Gene Product Result for
Synonyms: CD111 CLPED1 ED4 HIgR HVEC OFC7 PRR PRR1 PVRR PVRR1 SK-12 nectin-1
UniProtKB ID: Q15223, O75465, Q2M3D3, Q9HBE6, Q9HBW2
Gene ID:
Human(5818) Summary: This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
Mouse(58235) poliovirus receptor-related 1
Rat(192183) poliovirus receptor-related 1
dog(489363) poliovirus receptor-related 1 (herpesvirus entry mediator C)
domestic cat(101098252) poliovirus receptor-related 1 (herpesvirus entry mediator C)
cow(533492) poliovirus receptor-related 1 (herpesvirus entry mediator C)
sheep(101116172) poliovirus receptor-related 1 (herpesvirus entry mediator C)
domestic guinea pig(100724766) poliovirus receptor-related 1 (herpesvirus entry mediator C)
naked mole-rat(101713982) poliovirus receptor-related 1 (herpesvirus entry mediator C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002855 Rosetta Predictions human pricing
NM_203285 Rosetta Predictions human pricing
NM_203286 Rosetta Predictions human pricing
XM_001066246 Rosetta Predictions rat pricing
XM_236210 Rosetta Predictions rat pricing
NM_021424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046268 predicted 595
2 SASI_Hs01_00046269 predicted 538
3 SASI_Hs02_00334604 predicted 842
4 SASI_Hs01_00046270 predicted 520
5 SASI_Hs01_00046271 predicted 887
6 SASI_Hs01_00046272 predicted 901
7 SASI_Hs01_00046274 predicted 268
8 SASI_Hs01_00046275 predicted 280
9 SASI_Hs02_00334605 predicted 546
10 SASI_Hs02_00334606 predicted 380
11 SASI_Hs01_00046273 predicted 870
12 SASI_Hs01_00046276 predicted 866
13 SASI_Hs01_00046277 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129976 predicted 602
2 SASI_Hs01_00129977 predicted 538
3 SASI_Hs02_00373185 predicted 841
4 SASI_Hs01_00129978 predicted 521
5 SASI_Hs01_00129979 predicted 884
6 SASI_Hs01_00129980 predicted 896
7 SASI_Hs01_00129982 predicted 268
8 SASI_Hs01_00129983 predicted 274
9 SASI_Hs02_00373186 predicted 546
10 SASI_Hs02_00373187 predicted 380
11 SASI_Hs01_00129981 predicted 874
12 SASI_Hs01_00129984 predicted 867
13 SASI_Hs01_00129985 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213808 predicted 599
2 SASI_Hs01_00213809 predicted 544
3 SASI_Hs02_00373188 predicted 840
4 SASI_Hs01_00213810 predicted 529
5 SASI_Hs01_00213811 predicted 881
6 SASI_Hs01_00213812 predicted 896
7 SASI_Hs01_00213814 predicted 266
8 SASI_Hs01_00213815 predicted 276
9 SASI_Hs02_00373189 predicted 543
10 SASI_Hs02_00373190 predicted 381
11 SASI_Hs01_00213813 predicted 869
12 SASI_Hs01_00213816 predicted 864
13 SASI_Hs01_00213817 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316794 predicted 784
2 SASI_Rn02_00316795 predicted 887
3 SASI_Rn02_00316796 predicted 925
4 SASI_Rn02_00316797 predicted 988
5 SASI_Rn02_00316798 predicted 521
6 SASI_Rn02_00316799 predicted 1346
7 SASI_Rn02_00316800 predicted 1210
8 SASI_Rn02_00316801 predicted 392
9 SASI_Rn02_00316802 predicted 620
10 SASI_Rn02_00316803 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389873 predicted 782
2 SASI_Rn02_00389874 predicted 888
3 SASI_Rn02_00389875 predicted 929
4 SASI_Rn02_00389876 predicted 986
5 SASI_Rn02_00389877 predicted 524
6 SASI_Rn02_00389878 predicted 1346
7 SASI_Rn02_00389879 predicted 1216
8 SASI_Rn02_00389880 predicted 391
9 SASI_Rn02_00389881 predicted 627
10 SASI_Rn02_00389882 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145931 predicted 671
2 SASI_Mm01_00145932 predicted 868
3 SASI_Mm01_00145933 predicted 736
4 SASI_Mm01_00145934 predicted 823
5 SASI_Mm01_00145935 predicted 834
6 SASI_Mm01_00145936 predicted 781
7 SASI_Mm01_00145937 predicted 435
8 SASI_Mm01_00145938 predicted 944
9 SASI_Mm01_00145939 predicted 426
10 SASI_Mm01_00145940 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021424
VALIDATED
PVRL1 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-786s1c1
Sequence:CCGGACGCTCAACGTGCAGTATGAACTCGAGTTCATACTGCACGTTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-3121s1c1
Sequence:CCGGCCCTCATTCTAAATGGGCATTCTCGAGAATGCCCATTTAGAATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-783s1c1
Sequence:CCGGCTTACGCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-905s1c1
Sequence:CCGGGTACCACTGGACCACATTGAACTCGAGTTCAATGTGGTCCAGTGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021424.2-1577s1c1
Sequence:CCGGCGACGGGTCTTTCATTTCCAACTCGAGTTGGAAATGAAAGACCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-2800s21c1
Sequence:CCGGGGGACTGCTAGCGTCTCATATCTCGAGATATGAGACGCTAGCAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-739s21c1
Sequence:CCGGTGGCCTGCATTGTCAACTATCCTCGAGGATAGTTGACAATGCAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-303s21c1
Sequence:CCGGGCCATCTACAACCCGACTATGCTCGAGCATAGTCGGGTTGTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021424.2-617s21c1
Sequence:CCGGGTCCTGGGAAACACGGCTAAACTCGAGTTTAGCCGTGTTTCCCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021424
VALIDATED
PVRL1 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-786s1c1
Sequence:CCGGACGCTCAACGTGCAGTATGAACTCGAGTTCATACTGCACGTTGAGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-3121s1c1
Sequence:CCGGCCCTCATTCTAAATGGGCATTCTCGAGAATGCCCATTTAGAATGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-783s1c1
Sequence:CCGGCTTACGCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGCGTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-905s1c1
Sequence:CCGGGTACCACTGGACCACATTGAACTCGAGTTCAATGTGGTCCAGTGGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021424.2-1577s1c1
Sequence:CCGGCGACGGGTCTTTCATTTCCAACTCGAGTTGGAAATGAAAGACCCGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-2800s21c1
Sequence:CCGGGGGACTGCTAGCGTCTCATATCTCGAGATATGAGACGCTAGCAGTCCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-739s21c1
Sequence:CCGGTGGCCTGCATTGTCAACTATCCTCGAGGATAGTTGACAATGCAGGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-303s21c1
Sequence:CCGGGCCATCTACAACCCGACTATGCTCGAGCATAGTCGGGTTGTAGATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000284549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021424.2-617s21c1
Sequence:CCGGGTCCTGGGAAACACGGCTAAACTCGAGTTTAGCCGTGTTTCCCAGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021424
VALIDATED
PVRL1 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-786s1c1
Sequence:CCGGACGCTCAACGTGCAGTATGAACTCGAGTTCATACTGCACGTTGAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-3121s1c1
Sequence:CCGGCCCTCATTCTAAATGGGCATTCTCGAGAATGCCCATTTAGAATGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-783s1c1
Sequence:CCGGCTTACGCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGCGTAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021424.2-905s1c1
Sequence:CCGGGTACCACTGGACCACATTGAACTCGAGTTCAATGTGGTCCAGTGGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021424.2-1577s1c1
Sequence:CCGGCGACGGGTCTTTCATTTCCAACTCGAGTTGGAAATGAAAGACCCGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-2800s21c1
Sequence:CCGGGGGACTGCTAGCGTCTCATATCTCGAGATATGAGACGCTAGCAGTCCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-739s21c1
Sequence:CCGGTGGCCTGCATTGTCAACTATCCTCGAGGATAGTTGACAATGCAGGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021424.2-303s21c1
Sequence:CCGGGCCATCTACAACCCGACTATGCTCGAGCATAGTCGGGTTGTAGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000284549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021424.2-617s21c1
Sequence:CCGGGTCCTGGGAAACACGGCTAAACTCGAGTTTAGCCGTGTTTCCCAGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002855
VALIDATED
PVRL1 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1057s1c1
Sequence:CCGGCCAGAACAGAACCCTCTTCTTCTCGAGAAGAAGAGGGTTCTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002855.3-711s1c1
Sequence:CCGGCCAGTGTGGTATCCTGGGAAACTCGAGTTTCCCAGGATACCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-280s1c1
Sequence:CCGGCGACTCCATGTATGGCTTCATCTCGAGATGAAGCCATACATGGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-887s1c1
Sequence:CCGGCTCACTCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1568s1c1
Sequence:CCGGCGGCCCTACTTCACCGTGGATCTCGAGATCCACGGTGAAGTAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1341s21c1
Sequence:CCGGGCACCAAGAAGCACGTGTATGCTCGAGCATACACGTGCTTCTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1150s21c1
Sequence:CCGGAGGCCAGGTGGAGGTCAATATCTCGAGATATTGACCTCCACCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1010s21c1
Sequence:CCGGTACCACTGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCAGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002855
VALIDATED
PVRL1 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1057s1c1
Sequence:CCGGCCAGAACAGAACCCTCTTCTTCTCGAGAAGAAGAGGGTTCTGTTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000062937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002855.3-711s1c1
Sequence:CCGGCCAGTGTGGTATCCTGGGAAACTCGAGTTTCCCAGGATACCACACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000062933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-280s1c1
Sequence:CCGGCGACTCCATGTATGGCTTCATCTCGAGATGAAGCCATACATGGAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000062935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-887s1c1
Sequence:CCGGCTCACTCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGAGTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000062936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1568s1c1
Sequence:CCGGCGGCCCTACTTCACCGTGGATCTCGAGATCCACGGTGAAGTAGGGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1341s21c1
Sequence:CCGGGCACCAAGAAGCACGTGTATGCTCGAGCATACACGTGCTTCTTGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000379037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1150s21c1
Sequence:CCGGAGGCCAGGTGGAGGTCAATATCTCGAGATATTGACCTCCACCTGGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1010s21c1
Sequence:CCGGTACCACTGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCAGTGGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002855
VALIDATED
PVRL1 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 1 (herpesvirus entry mediator C)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1057s1c1
Sequence:CCGGCCAGAACAGAACCCTCTTCTTCTCGAGAAGAAGAGGGTTCTGTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000062937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002855.3-711s1c1
Sequence:CCGGCCAGTGTGGTATCCTGGGAAACTCGAGTTTCCCAGGATACCACACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000062933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-280s1c1
Sequence:CCGGCGACTCCATGTATGGCTTCATCTCGAGATGAAGCCATACATGGAGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000062935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-887s1c1
Sequence:CCGGCTCACTCTCAACGTGCAGTATCTCGAGATACTGCACGTTGAGAGTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000062936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002855.3-1568s1c1
Sequence:CCGGCGGCCCTACTTCACCGTGGATCTCGAGATCCACGGTGAAGTAGGGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1341s21c1
Sequence:CCGGGCACCAAGAAGCACGTGTATGCTCGAGCATACACGTGCTTCTTGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1150s21c1
Sequence:CCGGAGGCCAGGTGGAGGTCAATATCTCGAGATATTGACCTCCACCTGGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002855.4-1010s21c1
Sequence:CCGGTACCACTGGACCACGCTAAATCTCGAGATTTAGCGTGGTCCAGTGGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???