EMAIL THIS PAGE TO A FRIEND

PVRL2

poliovirus receptor-related 2 (herpesvirus entry mediator B)

158 Gene Product Result for
Synonyms: CD112 HVEB PRR2 PVRR2
UniProtKB ID: Q92692, O75455, Q6IBI6, Q96J29
Gene ID:
Human(5819) Summary: This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(19294) poliovirus receptor-related 2
Rat(308417) poliovirus receptor-related 2
Horse(100065463) poliovirus receptor-related 2 (herpesvirus entry mediator B)
dog(611060) poliovirus receptor-related 2 (herpesvirus entry mediator B)
naked mole-rat(101715823) poliovirus receptor-related 2 (herpesvirus entry mediator B)
domestic guinea pig(100730603) poliovirus receptor-related 2 (herpesvirus entry mediator B)
cow(505580) poliovirus receptor-related 2 (herpesvirus entry mediator B)
sheep(101111996) poliovirus receptor-related 2 (herpesvirus entry mediator B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002856 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075981 MISSION® esiRNA esiRNA human PVRL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042724 Rosetta Predictions human pricing
NM_002856 Rosetta Predictions human pricing
NM_001012064 Rosetta Predictions rat pricing
XM_574380 Rosetta Predictions rat pricing
NM_008990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311089 predicted 1131
2 SASI_Hs02_00311090 predicted 1099
3 SASI_Hs02_00311091 predicted 999
4 SASI_Hs02_00311092 predicted 1005
5 SASI_Hs02_00311093 predicted 1126
6 SASI_Hs02_00311094 predicted 1179
7 SASI_Hs02_00311095 predicted 1197
8 SASI_Hs02_00311096 predicted 716
9 SASI_Hs02_00311097 predicted 1103
10 SASI_Hs02_00311098 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178726 predicted 1128
2 SASI_Hs01_00178727 predicted 1090
3 SASI_Hs01_00178728 predicted 991
4 SASI_Hs01_00178729 predicted 1001
5 SASI_Hs01_00178730 predicted 1122
6 SASI_Hs01_00178732 predicted 1178
7 SASI_Hs02_00334607 predicted 1196
8 SASI_Hs02_00334608 predicted 716
9 SASI_Hs02_00334609 predicted 1103
10 SASI_Hs02_00334610 predicted 707
11 SASI_Hs01_00178725 predicted 973
12 SASI_Hs01_00178731 predicted 993
13 SASI_Hs01_00178733 predicted 943
14 SASI_Hs01_00178734 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081590 predicted 1432
2 SASI_Rn01_00081591 predicted 2101
3 SASI_Rn01_00081592 predicted 981
4 SASI_Rn01_00081593 predicted 587
5 SASI_Rn01_00081595 predicted 1137
6 SASI_Rn01_00081596 predicted 755
7 SASI_Rn01_00081597 predicted 1715
8 SASI_Rn02_00200170 predicted 653
9 SASI_Rn01_00081598 predicted 668
10 SASI_Rn02_00200171 predicted 1946
11 SASI_Rn01_00081594 predicted 2099
12 SASI_Rn01_00081599 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167992 predicted 1990
2 SASI_Rn01_00167993 predicted 1101
3 SASI_Rn01_00167994 predicted 2586
4 SASI_Rn01_00167995 predicted 2469
5 SASI_Rn01_00167996 predicted 2701
6 SASI_Rn01_00167997 predicted 2648
7 SASI_Rn01_00167998 predicted 2714
8 SASI_Rn01_00167999 predicted 2033
9 SASI_Rn01_00168000 predicted 2057
10 SASI_Rn01_00168001 predicted 2374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028492 predicted 936
2 SASI_Mm01_00028494 predicted 1440
3 SASI_Mm01_00028495 predicted 718
4 SASI_Mm01_00028496 predicted 786
5 SASI_Mm01_00028497 predicted 1097
6 SASI_Mm01_00028498 predicted 592
7 SASI_Mm01_00028499 predicted 1401
8 SASI_Mm01_00028500 predicted 1016
9 SASI_Mm02_00315087 predicted 1208
10 SASI_Mm01_00028501 predicted 847
11 SASI_Mm01_00028493 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008990
PVRL2 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1545s21c1
Sequence:CCGGCAGTGAAGACGCCATACTTTGCTCGAGCAAAGTATGGCGTCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1445s21c1
Sequence:CCGGGAAGGACCTCCCTCCTATAAACTCGAGTTTATAGGAGGGAGGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-515s21c1
Sequence:CCGGCCATCCTTCGGAGTGGATTTCCTCGAGGAAATCCACTCCGAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008990.3-2176s21c1
Sequence:CCGGAGTATCTCAAGAACCCTTAAACTCGAGTTTAAGGGTTCTTGAGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008990.2-1803s1c1
Sequence:CCGGCCATGAGCTTTCCACCAGTAACTCGAGTTACTGGTGGAAAGCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-924s1c1
Sequence:CCGGGAAGTATCCATCTCCGGCTATCTCGAGATAGCCGGAGATGGATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-1712s1c1
Sequence:CCGGCTCCTACCAGAGCAAAGACTTCTCGAGAAGTCTTTGCTCTGGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-975s1c1
Sequence:CCGGGCCATACTGACCTGTGATGTACTCGAGTACATCACAGGTCAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-788s1c1
Sequence:CCGGCGTCACTATCATCAGCCGATACTCGAGTATCGGCTGATGATAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008990
PVRL2 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1545s21c1
Sequence:CCGGCAGTGAAGACGCCATACTTTGCTCGAGCAAAGTATGGCGTCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1445s21c1
Sequence:CCGGGAAGGACCTCCCTCCTATAAACTCGAGTTTATAGGAGGGAGGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-515s21c1
Sequence:CCGGCCATCCTTCGGAGTGGATTTCCTCGAGGAAATCCACTCCGAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008990.3-2176s21c1
Sequence:CCGGAGTATCTCAAGAACCCTTAAACTCGAGTTTAAGGGTTCTTGAGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008990.2-1803s1c1
Sequence:CCGGCCATGAGCTTTCCACCAGTAACTCGAGTTACTGGTGGAAAGCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-924s1c1
Sequence:CCGGGAAGTATCCATCTCCGGCTATCTCGAGATAGCCGGAGATGGATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-1712s1c1
Sequence:CCGGCTCCTACCAGAGCAAAGACTTCTCGAGAAGTCTTTGCTCTGGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-975s1c1
Sequence:CCGGGCCATACTGACCTGTGATGTACTCGAGTACATCACAGGTCAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-788s1c1
Sequence:CCGGCGTCACTATCATCAGCCGATACTCGAGTATCGGCTGATGATAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008990
PVRL2 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1545s21c1
Sequence:CCGGCAGTGAAGACGCCATACTTTGCTCGAGCAAAGTATGGCGTCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-1445s21c1
Sequence:CCGGGAAGGACCTCCCTCCTATAAACTCGAGTTTATAGGAGGGAGGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008990.3-515s21c1
Sequence:CCGGCCATCCTTCGGAGTGGATTTCCTCGAGGAAATCCACTCCGAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008990.3-2176s21c1
Sequence:CCGGAGTATCTCAAGAACCCTTAAACTCGAGTTTAAGGGTTCTTGAGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008990.2-1803s1c1
Sequence:CCGGCCATGAGCTTTCCACCAGTAACTCGAGTTACTGGTGGAAAGCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-924s1c1
Sequence:CCGGGAAGTATCCATCTCCGGCTATCTCGAGATAGCCGGAGATGGATACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-1712s1c1
Sequence:CCGGCTCCTACCAGAGCAAAGACTTCTCGAGAAGTCTTTGCTCTGGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-975s1c1
Sequence:CCGGGCCATACTGACCTGTGATGTACTCGAGTACATCACAGGTCAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008990.2-788s1c1
Sequence:CCGGCGTCACTATCATCAGCCGATACTCGAGTATCGGCTGATGATAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002856
VALIDATED
PVRL2 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1710s1c1
Sequence:CCGGCCTCCCACTTTCTTGGGACTTCTCGAGAAGTCCCAAGAAAGTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1173s1c1
Sequence:CCGGCAGGTCATCTTTGTCCGAGAACTCGAGTTCTCGGACAAAGATGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-240s1c1
Sequence:CCGGGCCCAGGATGTGCGAGTTCAACTCGAGTTGAACTCGCACATCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-372s1c1
Sequence:CCGGGCACCTGCGAACCACCAGAATCTCGAGATTCTGGTGGTTCGCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002856.1-1407s1c1
Sequence:CCGGCCCGTCTTCTGGACACCAGTACTCGAGTACTGGTGTCCAGAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002856
VALIDATED
PVRL2 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1710s1c1
Sequence:CCGGCCTCCCACTTTCTTGGGACTTCTCGAGAAGTCCCAAGAAAGTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1173s1c1
Sequence:CCGGCAGGTCATCTTTGTCCGAGAACTCGAGTTCTCGGACAAAGATGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-240s1c1
Sequence:CCGGGCCCAGGATGTGCGAGTTCAACTCGAGTTGAACTCGCACATCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-372s1c1
Sequence:CCGGGCACCTGCGAACCACCAGAATCTCGAGATTCTGGTGGTTCGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002856.1-1407s1c1
Sequence:CCGGCCCGTCTTCTGGACACCAGTACTCGAGTACTGGTGTCCAGAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002856
VALIDATED
PVRL2 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 2 (herpesvirus entry mediator B)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1710s1c1
Sequence:CCGGCCTCCCACTTTCTTGGGACTTCTCGAGAAGTCCCAAGAAAGTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-1173s1c1
Sequence:CCGGCAGGTCATCTTTGTCCGAGAACTCGAGTTCTCGGACAAAGATGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-240s1c1
Sequence:CCGGGCCCAGGATGTGCGAGTTCAACTCGAGTTGAACTCGCACATCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002856.1-372s1c1
Sequence:CCGGGCACCTGCGAACCACCAGAATCTCGAGATTCTGGTGGTTCGCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002856.1-1407s1c1
Sequence:CCGGCCCGTCTTCTGGACACCAGTACTCGAGTACTGGTGTCCAGAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)