EMAIL THIS PAGE TO A FRIEND

PVRL3

poliovirus receptor-related 3

81 Gene Product Result for
Synonyms: CD113 CDW113 NECTIN-3 PPR3 PRR3 PVRR3
Gene ID:
Human(25945) Summary: This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(58998) poliovirus receptor-related 3
Rat(288124) poliovirus receptor-related 3
chicken(418415) poliovirus receptor-related 3
dog(478559) poliovirus receptor-related 3
domestic cat(101094872) poliovirus receptor-related 3
cow(534360) poliovirus receptor-related 3
sheep(101113983) poliovirus receptor-related 3
domestic guinea pig(100732753) poliovirus receptor-related 3
naked mole-rat(101705809) poliovirus receptor-related 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084221 MISSION® esiRNA esiRNA human PVRL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015480 Rosetta Predictions human pricing
NM_001105883 Rosetta Predictions rat pricing
NM_021495 Rosetta Predictions mouse pricing
NM_021496 Rosetta Predictions mouse pricing
NM_021497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128816 predicted 673
2 SASI_Hs01_00128817 predicted 485
3 SASI_Hs01_00128818 predicted 383
4 SASI_Hs01_00128819 predicted 441
5 SASI_Hs01_00128820 predicted 976
6 SASI_Hs01_00128821 predicted 943
7 SASI_Hs01_00128822 predicted 1016
8 SASI_Hs01_00128823 predicted 829
9 SASI_Hs01_00128824 predicted 374
10 SASI_Hs01_00128825 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213472 predicted 235
2 SASI_Rn02_00213473 predicted 808
3 SASI_Rn02_00213474 predicted 390
4 SASI_Rn02_00213475 predicted 259
5 SASI_Rn02_00213476 predicted 1370
6 SASI_Rn02_00213477 predicted 834
7 SASI_Rn02_00213478 predicted 634
8 SASI_Rn02_00213479 predicted 1029
9 SASI_Rn02_00213480 predicted 841
10 SASI_Rn02_00213481 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081170 predicted 861
2 SASI_Mm01_00081171 predicted 817
3 SASI_Mm01_00081172 predicted 983
4 SASI_Mm01_00081173 predicted 636
5 SASI_Mm01_00081174 predicted 570
6 SASI_Mm01_00081175 predicted 954
7 SASI_Mm01_00081176 predicted 775
8 SASI_Mm01_00081177 predicted 1008
9 SASI_Mm01_00081178 predicted 791
10 SASI_Mm01_00081179 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133432 predicted 670
2 SASI_Mm01_00133433 predicted 632
3 SASI_Mm01_00133434 predicted 793
4 SASI_Mm01_00133435 predicted 441
5 SASI_Mm01_00133436 predicted 380
6 SASI_Mm01_00133437 predicted 765
7 SASI_Mm01_00133438 predicted 581
8 SASI_Mm01_00133439 predicted 816
9 SASI_Mm01_00133440 predicted 604
10 SASI_Mm01_00133441 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127587 predicted 670
2 SASI_Mm01_00127588 predicted 628
3 SASI_Mm01_00127589 predicted 796
4 SASI_Mm01_00127590 predicted 441
5 SASI_Mm01_00127591 predicted 378
6 SASI_Mm01_00127592 predicted 757
7 SASI_Mm01_00127593 predicted 587
8 SASI_Mm01_00127594 predicted 816
9 SASI_Mm01_00127595 predicted 601
10 SASI_Mm01_00127596 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015480
VALIDATED
PVRL3 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015480.1-161s1c1
Sequence:CCGGGTGCCTTAGCTGGACCAATTACTCGAGTAATTGGTCCAGCTAAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-726s1c1
Sequence:CCGGGCGAATTACTTGTGTTGTAAACTCGAGTTTACAACACAAGTAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1161s1c1
Sequence:CCGGGCCCTTCCCATTGTCAACTTTCTCGAGAAAGTTGACAATGGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-975s1c1
Sequence:CCGGCCATCCATTGACTTTCAATTACTCGAGTAATTGAAAGTCAATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1207s1c1
Sequence:CCGGGCCACGATCATTGCTAGTGTACTCGAGTACACTAGCAATGATCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-682s21c1
Sequence:CCGGATCAGCCAGTACAAGCTATTTCTCGAGAAATAGCTTGTACTGGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1084s21c1
Sequence:CCGGACCACCCTTCAGCCTACAATTCTCGAGAATTGTAGGCTGAAGGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1432s21c1
Sequence:CCGGGTGAACAATCTAATACGTAAACTCGAGTTTACGTATTAGATTGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-769s21c1
Sequence:CCGGATCCGATACTCTTTCATATTACTCGAGTAATATGAAAGAGTATCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015480
VALIDATED
PVRL3 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015480.1-161s1c1
Sequence:CCGGGTGCCTTAGCTGGACCAATTACTCGAGTAATTGGTCCAGCTAAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-726s1c1
Sequence:CCGGGCGAATTACTTGTGTTGTAAACTCGAGTTTACAACACAAGTAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1161s1c1
Sequence:CCGGGCCCTTCCCATTGTCAACTTTCTCGAGAAAGTTGACAATGGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-975s1c1
Sequence:CCGGCCATCCATTGACTTTCAATTACTCGAGTAATTGAAAGTCAATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1207s1c1
Sequence:CCGGGCCACGATCATTGCTAGTGTACTCGAGTACACTAGCAATGATCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-682s21c1
Sequence:CCGGATCAGCCAGTACAAGCTATTTCTCGAGAAATAGCTTGTACTGGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1084s21c1
Sequence:CCGGACCACCCTTCAGCCTACAATTCTCGAGAATTGTAGGCTGAAGGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1432s21c1
Sequence:CCGGGTGAACAATCTAATACGTAAACTCGAGTTTACGTATTAGATTGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-769s21c1
Sequence:CCGGATCCGATACTCTTTCATATTACTCGAGTAATATGAAAGAGTATCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015480
VALIDATED
PVRL3 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015480.1-161s1c1
Sequence:CCGGGTGCCTTAGCTGGACCAATTACTCGAGTAATTGGTCCAGCTAAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-726s1c1
Sequence:CCGGGCGAATTACTTGTGTTGTAAACTCGAGTTTACAACACAAGTAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1161s1c1
Sequence:CCGGGCCCTTCCCATTGTCAACTTTCTCGAGAAAGTTGACAATGGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-975s1c1
Sequence:CCGGCCATCCATTGACTTTCAATTACTCGAGTAATTGAAAGTCAATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015480.1-1207s1c1
Sequence:CCGGGCCACGATCATTGCTAGTGTACTCGAGTACACTAGCAATGATCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-682s21c1
Sequence:CCGGATCAGCCAGTACAAGCTATTTCTCGAGAAATAGCTTGTACTGGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1084s21c1
Sequence:CCGGACCACCCTTCAGCCTACAATTCTCGAGAATTGTAGGCTGAAGGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-1432s21c1
Sequence:CCGGGTGAACAATCTAATACGTAAACTCGAGTTTACGTATTAGATTGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015480.1-769s21c1
Sequence:CCGGATCCGATACTCTTTCATATTACTCGAGTAATATGAAAGAGTATCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021495
VALIDATED
PVRL3 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-1127s1c1
Sequence:CCGGGATGGTTTATTGGCGTCAGATCTCGAGATCTGACGCCAATAAACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021495.1-2003s1c1
Sequence:CCGGTCAATGTATCTGAGCTGCTTTCTCGAGAAAGCAGCTCAGATACATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021495.1-1493s1c1
Sequence:CCGGCGTGGAGACTACTTTGCCAAACTCGAGTTTGGCAAAGTAGTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-639s1c1
Sequence:CCGGCCGTTACATTCCCACTTGGAACTCGAGTTCCAAGTGGGAATGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021495.1-1165s1c1
Sequence:CCGGCCATCCATTGACTGTCAATTACTCGAGTAATTGACAGTCAATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1800s21c1
Sequence:CCGGATGTAGATGGCTCCGTAATTTCTCGAGAAATTACGGAGCCATCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-353s21c1
Sequence:CCGGGGTGCCTTAGCTGGATCAATTCTCGAGAATTGATCCAGCTAAGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-572s21c1
Sequence:CCGGTCACTTAATGATGCAACAATTCTCGAGAATTGTTGCATCATTAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1181s21c1
Sequence:CCGGGTCAATTATTCTGGCGTTTATCTCGAGATAAACGCCAGAATAATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021495.3-1863s21c1
Sequence:CCGGACTATGTACAAGGTTTCATTCCTCGAGGAATGAAACCTTGTACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021495
VALIDATED
PVRL3 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-1127s1c1
Sequence:CCGGGATGGTTTATTGGCGTCAGATCTCGAGATCTGACGCCAATAAACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021495.1-2003s1c1
Sequence:CCGGTCAATGTATCTGAGCTGCTTTCTCGAGAAAGCAGCTCAGATACATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021495.1-1493s1c1
Sequence:CCGGCGTGGAGACTACTTTGCCAAACTCGAGTTTGGCAAAGTAGTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-639s1c1
Sequence:CCGGCCGTTACATTCCCACTTGGAACTCGAGTTCCAAGTGGGAATGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021495.1-1165s1c1
Sequence:CCGGCCATCCATTGACTGTCAATTACTCGAGTAATTGACAGTCAATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1800s21c1
Sequence:CCGGATGTAGATGGCTCCGTAATTTCTCGAGAAATTACGGAGCCATCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-353s21c1
Sequence:CCGGGGTGCCTTAGCTGGATCAATTCTCGAGAATTGATCCAGCTAAGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-572s21c1
Sequence:CCGGTCACTTAATGATGCAACAATTCTCGAGAATTGTTGCATCATTAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1181s21c1
Sequence:CCGGGTCAATTATTCTGGCGTTTATCTCGAGATAAACGCCAGAATAATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021495.3-1863s21c1
Sequence:CCGGACTATGTACAAGGTTTCATTCCTCGAGGAATGAAACCTTGTACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021495
VALIDATED
PVRL3 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-1127s1c1
Sequence:CCGGGATGGTTTATTGGCGTCAGATCTCGAGATCTGACGCCAATAAACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021495.1-2003s1c1
Sequence:CCGGTCAATGTATCTGAGCTGCTTTCTCGAGAAAGCAGCTCAGATACATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021495.1-1493s1c1
Sequence:CCGGCGTGGAGACTACTTTGCCAAACTCGAGTTTGGCAAAGTAGTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021495.1-639s1c1
Sequence:CCGGCCGTTACATTCCCACTTGGAACTCGAGTTCCAAGTGGGAATGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021495.1-1165s1c1
Sequence:CCGGCCATCCATTGACTGTCAATTACTCGAGTAATTGACAGTCAATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1800s21c1
Sequence:CCGGATGTAGATGGCTCCGTAATTTCTCGAGAAATTACGGAGCCATCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-353s21c1
Sequence:CCGGGGTGCCTTAGCTGGATCAATTCTCGAGAATTGATCCAGCTAAGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-572s21c1
Sequence:CCGGTCACTTAATGATGCAACAATTCTCGAGAATTGTTGCATCATTAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021495.3-1181s21c1
Sequence:CCGGGTCAATTATTCTGGCGTTTATCTCGAGATAAACGCCAGAATAATTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021495.3-1863s21c1
Sequence:CCGGACTATGTACAAGGTTTCATTCCTCGAGGAATGAAACCTTGTACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)