EMAIL THIS PAGE TO A FRIEND

PVRL4

poliovirus receptor-related 4

133 Gene Product Result for
Synonyms: EDSS1 LNIR PRR4 nectin-4
UniProtKB ID: Q96NY8, Q96K15
Gene ID:
Human(81607) Summary: This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Mouse(71740) poliovirus receptor-related 4
Rat(498281) poliovirus receptor-related 4
Zebrafish(794920) poliovirus receptor-related 4
dog(609931) poliovirus receptor-related 4
Horse(100066309) poliovirus receptor-related 4
domestic cat(101092485) poliovirus receptor-related 4
naked mole-rat(101710379) poliovirus receptor-related 4
Domestic Rabbit(100348580) poliovirus receptor-related 4
domestic guinea pig(100734333) poliovirus receptor-related 4
cow(507718) poliovirus receptor-related 4
sheep(101123428) poliovirus receptor-related 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLLS1211 MCF10A CELLS PVRL4 (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118921 MISSION® esiRNA esiRNA human PVRL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030916 Rosetta Predictions human pricing
NM_001109076 Rosetta Predictions rat pricing
NM_001122680 Rosetta Predictions mouse pricing
NM_027893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358457 predicted 613
2 SASI_Hs01_00046925 predicted 304
3 SASI_Hs01_00046926 predicted 500
4 SASI_Hs01_00046927 predicted 1581
5 SASI_Hs01_00046928 predicted 1196
6 SASI_Hs01_00046929 predicted 1311
7 SASI_Hs01_00046930 predicted 707
8 SASI_Hs01_00046931 predicted 705
9 SASI_Hs01_00046932 predicted 1035
10 SASI_Hs01_00046933 predicted 1610
11 SASI_Hs01_00046934 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244890 predicted 2490
2 SASI_Rn02_00244891 predicted 1631
3 SASI_Rn02_00244892 predicted 1822
4 SASI_Rn02_00244893 predicted 1265
5 SASI_Rn02_00244894 predicted 918
6 SASI_Rn02_00244895 predicted 1572
7 SASI_Rn02_00244896 predicted 1438
8 SASI_Rn02_00244897 predicted 1105
9 SASI_Rn02_00244898 predicted 709
10 SASI_Rn02_00244899 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309224 predicted 1108
2 SASI_Mm02_00309225 predicted 1284
3 SASI_Mm02_00309226 predicted 943
4 SASI_Mm02_00309227 predicted 1059
5 SASI_Mm02_00309228 predicted 1272
6 SASI_Mm02_00309229 predicted 1442
7 SASI_Mm02_00309230 predicted 1461
8 SASI_Mm02_00309231 predicted 1417
9 SASI_Mm02_00309232 predicted 1409
10 SASI_Mm02_00309233 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150846 predicted 1107
2 SASI_Mm02_00332862 predicted 1290
3 SASI_Mm01_00150847 predicted 948
4 SASI_Mm02_00332863 predicted 1057
5 SASI_Mm01_00150848 predicted 1277
6 SASI_Mm01_00150849 predicted 1441
7 SASI_Mm01_00150850 predicted 1461
8 SASI_Mm02_00332864 predicted 1424
9 SASI_Mm01_00150854 predicted 1408
10 SASI_Mm02_00332865 predicted 551
11 SASI_Mm01_00150845 predicted 1431
12 SASI_Mm01_00150851 predicted 1382
13 SASI_Mm01_00150852 predicted 1740
14 SASI_Mm01_00150853 predicted 1698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030916
PVRL4 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-1717s21c1
Sequence:CCGGATCAGGATGAAGGCATCAAACCTCGAGGTTTGATGCCTTCATCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-355s21c1
Sequence:CCGGTGCTACTGCTGGCATCATTTACTCGAGTAAATGATGCCAGCAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030916.1-2560s1c1
Sequence:CCGGCCCTTTCCATTAGTTGTATTTCTCGAGAAATACAACTAATGGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-503s1c1
Sequence:CCGGCACTCCAAATACGGGCTTCATCTCGAGATGAAGCCCGTATTTGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1525s1c1
Sequence:CCGGCCCTGATAGTCTCAAGGACAACTCGAGTTGTCCTTGAGACTATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1613s1c1
Sequence:CCGGGAGATAGAAACACAGACTGAACTCGAGTTCAGTCTGTGTTTCTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1325s1c1
Sequence:CCGGGCCGCACTCTTGTTCTGCCTTCTCGAGAAGGCAGAACAAGAGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030916
PVRL4 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-1717s21c1
Sequence:CCGGATCAGGATGAAGGCATCAAACCTCGAGGTTTGATGCCTTCATCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-355s21c1
Sequence:CCGGTGCTACTGCTGGCATCATTTACTCGAGTAAATGATGCCAGCAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030916.1-2560s1c1
Sequence:CCGGCCCTTTCCATTAGTTGTATTTCTCGAGAAATACAACTAATGGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-503s1c1
Sequence:CCGGCACTCCAAATACGGGCTTCATCTCGAGATGAAGCCCGTATTTGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1525s1c1
Sequence:CCGGCCCTGATAGTCTCAAGGACAACTCGAGTTGTCCTTGAGACTATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1613s1c1
Sequence:CCGGGAGATAGAAACACAGACTGAACTCGAGTTCAGTCTGTGTTTCTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1325s1c1
Sequence:CCGGGCCGCACTCTTGTTCTGCCTTCTCGAGAAGGCAGAACAAGAGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030916
PVRL4 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-1717s21c1
Sequence:CCGGATCAGGATGAAGGCATCAAACCTCGAGGTTTGATGCCTTCATCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030916.2-355s21c1
Sequence:CCGGTGCTACTGCTGGCATCATTTACTCGAGTAAATGATGCCAGCAGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030916.1-2560s1c1
Sequence:CCGGCCCTTTCCATTAGTTGTATTTCTCGAGAAATACAACTAATGGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-503s1c1
Sequence:CCGGCACTCCAAATACGGGCTTCATCTCGAGATGAAGCCCGTATTTGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1525s1c1
Sequence:CCGGCCCTGATAGTCTCAAGGACAACTCGAGTTGTCCTTGAGACTATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1613s1c1
Sequence:CCGGGAGATAGAAACACAGACTGAACTCGAGTTCAGTCTGTGTTTCTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030916.1-1325s1c1
Sequence:CCGGGCCGCACTCTTGTTCTGCCTTCTCGAGAAGGCAGAACAAGAGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027893
PVRL4 MISSION shRNA Bacterial Glycerol Stock
poliovirus receptor-related 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1102s1c1
Sequence:CCGGCAAATACAACTGGACACGGTTCTCGAGAACCGTGTCCAGTTGTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1682s1c1
Sequence:CCGGGATCAGGATGAAGGCATCAAACTCGAGTTTGATGCCTTCATCCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027893.1-3115s1c1
Sequence:CCGGGCCTGAAATCTGCTGGTCTAACTCGAGTTAGACCAGCAGATTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1402s1c1
Sequence:CCGGCCAGCAGATGACCCAGAAATACTCGAGTATTTCTGGGTCATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-335s1c1
Sequence:CCGGGCATCGTTTACAGGCCAATATCTCGAGATATTGGCCTGTAAACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027893
PVRL4 MISSION shRNA shRNA Plasmid DNA
poliovirus receptor-related 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1102s1c1
Sequence:CCGGCAAATACAACTGGACACGGTTCTCGAGAACCGTGTCCAGTTGTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1682s1c1
Sequence:CCGGGATCAGGATGAAGGCATCAAACTCGAGTTTGATGCCTTCATCCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027893.1-3115s1c1
Sequence:CCGGGCCTGAAATCTGCTGGTCTAACTCGAGTTAGACCAGCAGATTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1402s1c1
Sequence:CCGGCCAGCAGATGACCCAGAAATACTCGAGTATTTCTGGGTCATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-335s1c1
Sequence:CCGGGCATCGTTTACAGGCCAATATCTCGAGATATTGGCCTGTAAACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027893
PVRL4 MISSION shRNA Lentiviral Transduction Particles
poliovirus receptor-related 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1102s1c1
Sequence:CCGGCAAATACAACTGGACACGGTTCTCGAGAACCGTGTCCAGTTGTATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1682s1c1
Sequence:CCGGGATCAGGATGAAGGCATCAAACTCGAGTTTGATGCCTTCATCCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027893.1-3115s1c1
Sequence:CCGGGCCTGAAATCTGCTGGTCTAACTCGAGTTAGACCAGCAGATTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-1402s1c1
Sequence:CCGGCCAGCAGATGACCCAGAAATACTCGAGTATTTCTGGGTCATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027893.1-335s1c1
Sequence:CCGGGCATCGTTTACAGGCCAATATCTCGAGATATTGGCCTGTAAACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)