EMAIL THIS PAGE TO A FRIEND

PWP1

PWP1 homolog (S. cerevisiae)

70 Gene Product Result for
Synonyms: IEF-SSP-9502
UniProtKB ID: Q13610, A8K3R6
Gene ID:
Mouse(103136) PWP1 homolog (S. cerevisiae)
Rat(362856) PWP1 homolog (S. cerevisiae)
Zebrafish(393262) PWP1 homolog (S. cerevisiae)
domestic cat(101089703) PWP1 homolog (S. cerevisiae)
dog(474526) PWP1 homolog (S. cerevisiae)
chicken(418066) PWP1 homolog (S. cerevisiae)
cow(514147) PWP1 homolog (S. cerevisiae)
sheep(101117490) PWP1 homolog (S. cerevisiae)
domestic guinea pig(100734203) PWP1 homolog (S. cerevisiae)
Domestic Rabbit(100328736) PWP1 homolog (S. cerevisiae)
naked mole-rat(101717961) PWP1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007062 Rosetta Predictions human pricing
XM_001075998 Rosetta Predictions rat pricing
XM_343186 Rosetta Predictions rat pricing
NM_133993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055472 predicted 1581
2 SASI_Hs01_00055473 predicted 1222
3 SASI_Hs01_00055474 predicted 454
4 SASI_Hs01_00055477 predicted 1107
5 SASI_Hs02_00342875 predicted 1504
6 SASI_Hs01_00055478 predicted 459
7 SASI_Hs01_00055479 predicted 1180
8 SASI_Hs01_00055480 predicted 1327
9 SASI_Hs02_00342876 predicted 1476
10 SASI_Hs02_00342877 predicted 1456
11 SASI_Hs01_00055475 predicted 423
12 SASI_Hs01_00055476 predicted 1613
13 SASI_Hs01_00055481 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351733 predicted 1288
2 SASI_Rn02_00351734 predicted 1082
3 SASI_Rn02_00351735 predicted 343
4 SASI_Rn02_00351736 predicted 1288
5 SASI_Rn02_00351737 predicted 486
6 SASI_Rn02_00351738 predicted 437
7 SASI_Rn02_00351739 predicted 1301
8 SASI_Rn02_00351740 predicted 453
9 SASI_Rn02_00351741 predicted 1196
10 SASI_Rn02_00351742 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395453 predicted 1287
2 SASI_Rn02_00395454 predicted 1083
3 SASI_Rn02_00395455 predicted 1290
4 SASI_Rn02_00395456 predicted 1301
5 SASI_Rn02_00395457 predicted 2047
6 SASI_Rn02_00395458 predicted 2005
7 SASI_Rn02_00395459 predicted 1194
8 SASI_Rn02_00395460 predicted 1995
9 SASI_Rn02_00395461 predicted 2025
10 SASI_Rn02_00395462 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024632 predicted 672
2 SASI_Mm02_00339132 predicted 485
3 SASI_Mm01_00024633 predicted 1297
4 SASI_Mm01_00024634 predicted 1497
5 SASI_Mm02_00339133 predicted 1226
6 SASI_Mm01_00024637 predicted 1564
7 SASI_Mm02_00339134 predicted 412
8 SASI_Mm01_00024638 predicted 1600
9 SASI_Mm01_00024639 predicted 1209
10 SASI_Mm02_00339135 predicted 1391
11 SASI_Mm01_00024635 predicted 1473
12 SASI_Mm01_00024636 predicted 1453
13 SASI_Mm01_00024640 predicted 1299
14 SASI_Mm01_00024641 predicted 1661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007062
VALIDATED
PWP1 MISSION shRNA Bacterial Glycerol Stock
PWP1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1678s1c1
Sequence:CCGGGCAGAGTGACTGAAACACAATCTCGAGATTGTGTTTCAGTCACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-364s1c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-439s21c1
Sequence:CCGGCTTACGGTCTACGGGAGTAATCTCGAGATTACTCCCGTAGACCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-1256s1c1
Sequence:CCGGGTCTTGATCTTAGCAGTCAAACTCGAGTTTGACTGCTAAGATCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1598s1c1
Sequence:CCGGGATCATCTAATTTCCTGCTTACTCGAGTAAGCAGGAAATTAGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-751s1c1
Sequence:CCGGCTTGATATAGTGGACTCTTTACTCGAGTAAAGAGTCCACTATATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007062.1-875s1c1
Sequence:CCGGCATGGAATAAGCTAATCAGAACTCGAGTTCTGATTAGCTTATTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-526s1c1
Sequence:CCGGCCCAGTGATAATCTTATAGTTCTCGAGAACTATAAGATTATCACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1449s21c1
Sequence:CCGGGCTTCGGGTCTGGGATATAAGCTCGAGCTTATATCCCAGACCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1673s21c1
Sequence:CCGGACCATGCAGAGTGACTGAAACCTCGAGGTTTCAGTCACTCTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-364s21c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1527s21c1
Sequence:CCGGTGCAAGAAATTCATCTATTAGCTCGAGCTAATAGATGAATTTCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007062
VALIDATED
PWP1 MISSION shRNA shRNA Plasmid DNA
PWP1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1678s1c1
Sequence:CCGGGCAGAGTGACTGAAACACAATCTCGAGATTGTGTTTCAGTCACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-364s1c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-439s21c1
Sequence:CCGGCTTACGGTCTACGGGAGTAATCTCGAGATTACTCCCGTAGACCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-1256s1c1
Sequence:CCGGGTCTTGATCTTAGCAGTCAAACTCGAGTTTGACTGCTAAGATCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1598s1c1
Sequence:CCGGGATCATCTAATTTCCTGCTTACTCGAGTAAGCAGGAAATTAGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-751s1c1
Sequence:CCGGCTTGATATAGTGGACTCTTTACTCGAGTAAAGAGTCCACTATATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007062.1-875s1c1
Sequence:CCGGCATGGAATAAGCTAATCAGAACTCGAGTTCTGATTAGCTTATTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-526s1c1
Sequence:CCGGCCCAGTGATAATCTTATAGTTCTCGAGAACTATAAGATTATCACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1449s21c1
Sequence:CCGGGCTTCGGGTCTGGGATATAAGCTCGAGCTTATATCCCAGACCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1673s21c1
Sequence:CCGGACCATGCAGAGTGACTGAAACCTCGAGGTTTCAGTCACTCTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-364s21c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1527s21c1
Sequence:CCGGTGCAAGAAATTCATCTATTAGCTCGAGCTAATAGATGAATTTCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007062
VALIDATED
PWP1 MISSION shRNA Lentiviral Transduction Particles
PWP1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1678s1c1
Sequence:CCGGGCAGAGTGACTGAAACACAATCTCGAGATTGTGTTTCAGTCACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-364s1c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-439s21c1
Sequence:CCGGCTTACGGTCTACGGGAGTAATCTCGAGATTACTCCCGTAGACCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-1256s1c1
Sequence:CCGGGTCTTGATCTTAGCAGTCAAACTCGAGTTTGACTGCTAAGATCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007062.1-1598s1c1
Sequence:CCGGGATCATCTAATTTCCTGCTTACTCGAGTAAGCAGGAAATTAGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-751s1c1
Sequence:CCGGCTTGATATAGTGGACTCTTTACTCGAGTAAAGAGTCCACTATATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007062.1-875s1c1
Sequence:CCGGCATGGAATAAGCTAATCAGAACTCGAGTTCTGATTAGCTTATTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007062.1-526s1c1
Sequence:CCGGCCCAGTGATAATCTTATAGTTCTCGAGAACTATAAGATTATCACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1449s21c1
Sequence:CCGGGCTTCGGGTCTGGGATATAAGCTCGAGCTTATATCCCAGACCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1673s21c1
Sequence:CCGGACCATGCAGAGTGACTGAAACCTCGAGGTTTCAGTCACTCTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-364s21c1
Sequence:CCGGGCTGAGTACGACTTAGATAAACTCGAGTTTATCTAAGTCGTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007062.1-1527s21c1
Sequence:CCGGTGCAAGAAATTCATCTATTAGCTCGAGCTAATAGATGAATTTCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133993
VALIDATED
PWP1 MISSION shRNA Bacterial Glycerol Stock
PWP1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-853s1c1
Sequence:CCGGCCTTGACCTATCCTGGAATAACTCGAGTTATTCCAGGATAGGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133993.1-545s1c1
Sequence:CCGGGCTGAACAAGAGCAGTGCAATCTCGAGATTGCACTGCTCTTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133993.1-2331s1c1
Sequence:CCGGCCCATCTATTTCCTTCAAATACTCGAGTATTTGAAGGAAATAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-1515s1c1
Sequence:CCGGGCACGAAAGGTTTATCTGTTACTCGAGTAACAGATAAACCTTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-468s1c1
Sequence:CCGGCCTTGAAAGACACGGAACAATCTCGAGATTGTTCCGTGTCTTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133993
VALIDATED
PWP1 MISSION shRNA shRNA Plasmid DNA
PWP1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-853s1c1
Sequence:CCGGCCTTGACCTATCCTGGAATAACTCGAGTTATTCCAGGATAGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133993.1-545s1c1
Sequence:CCGGGCTGAACAAGAGCAGTGCAATCTCGAGATTGCACTGCTCTTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133993.1-2331s1c1
Sequence:CCGGCCCATCTATTTCCTTCAAATACTCGAGTATTTGAAGGAAATAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-1515s1c1
Sequence:CCGGGCACGAAAGGTTTATCTGTTACTCGAGTAACAGATAAACCTTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-468s1c1
Sequence:CCGGCCTTGAAAGACACGGAACAATCTCGAGATTGTTCCGTGTCTTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133993
VALIDATED
PWP1 MISSION shRNA Lentiviral Transduction Particles
PWP1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-853s1c1
Sequence:CCGGCCTTGACCTATCCTGGAATAACTCGAGTTATTCCAGGATAGGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133993.1-545s1c1
Sequence:CCGGGCTGAACAAGAGCAGTGCAATCTCGAGATTGCACTGCTCTTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133993.1-2331s1c1
Sequence:CCGGCCCATCTATTTCCTTCAAATACTCGAGTATTTGAAGGAAATAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-1515s1c1
Sequence:CCGGGCACGAAAGGTTTATCTGTTACTCGAGTAACAGATAAACCTTTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133993.1-468s1c1
Sequence:CCGGCCTTGAAAGACACGGAACAATCTCGAGATTGTTCCGTGTCTTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)