EMAIL THIS PAGE TO A FRIEND

PXDN

peroxidasin homolog (Drosophila)

219 Gene Product Result for
Synonyms: D2S448 D2S448E MG50 PRG2 PXN VPO
UniProtKB ID: Q92626, A8QM65, D6W4Y0, Q4KMG2
Gene ID:
Human(7837) Summary: Drosophila peroxidasin is an extracellular matrix-associated peroxidase (Horikoshi et al., 1999 [PubMed 10441517]
Mouse(69675) peroxidasin homolog (Drosophila)
Rat(554172) peroxidasin homolog (Drosophila)
chicken(421914) peroxidasin homolog (Drosophila)
dog(100687809) peroxidasin homolog (Drosophila)
domestic cat(101098455) peroxidasin homolog (Drosophila)
Horse(100072948) peroxidasin homolog (Drosophila)
cow(515860) peroxidasin homolog (Drosophila)
sheep(101112956) peroxidasin homolog (Drosophila)
naked mole-rat(101707101) peroxidasin homolog (Drosophila)
domestic guinea pig(100732082) peroxidasin homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402973 Monoclonal Anti-PXDN antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012293 Rosetta Predictions human pricing
XM_056455 Rosetta Predictions human pricing
XM_935180 Rosetta Predictions human pricing
XM_935181 Rosetta Predictions human pricing
XM_935182 Rosetta Predictions human pricing
XM_935183 Rosetta Predictions human pricing
XM_935184 Rosetta Predictions human pricing
XM_001053103 Rosetta Predictions rat pricing
NM_181395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344041 predicted 3669
2 SASI_Hs02_00344042 predicted 2110
3 SASI_Hs02_00344043 predicted 1286
4 SASI_Hs02_00344044 predicted 930
5 SASI_Hs02_00344045 predicted 2248
6 SASI_Hs02_00344046 predicted 936
7 SASI_Hs02_00344047 predicted 482
8 SASI_Hs02_00344048 predicted 446
9 SASI_Hs02_00344049 predicted 1891
10 SASI_Hs02_00344050 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_056455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284288 predicted 3607
2 SASI_Hs01_00284289 predicted 2058
3 SASI_Hs01_00284290 predicted 1227
4 SASI_Hs01_00284291 predicted 874
5 SASI_Hs01_00284292 predicted 2192
6 SASI_Hs01_00284293 predicted 886
7 SASI_Hs01_00284294 predicted 431
8 SASI_Hs01_00284295 predicted 1833
9 SASI_Hs01_00284296 predicted 3169
10 SASI_Hs01_00284297 predicted 3627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287404 predicted 218
2 SASI_Hs01_00287405 predicted 286
3 SASI_Hs01_00287406 predicted 227
4 SASI_Hs01_00287407 predicted 222
5 SASI_Hs01_00287408 predicted 221
6 SASI_Hs01_00287409 predicted 253
7 SASI_Hs01_00287410 predicted 214
8 SASI_Hs01_00287411 predicted 259
9 SASI_Hs01_00287412 predicted 221
10 SASI_Hs01_00287413 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293173 predicted 662
2 SASI_Hs01_00293174 predicted 504
3 SASI_Hs01_00293175 predicted 558
4 SASI_Hs01_00293176 predicted 649
5 SASI_Hs01_00293177 predicted 578
6 SASI_Hs01_00293178 predicted 489
7 SASI_Hs01_00293179 predicted 689
8 SASI_Hs01_00293180 predicted 601
9 SASI_Hs01_00293181 predicted 122
10 SASI_Hs01_00293182 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299636 predicted 1682
2 SASI_Hs01_00299637 predicted 259
3 SASI_Hs01_00299638 predicted 2532
4 SASI_Hs01_00299639 predicted 2265
5 SASI_Hs01_00299640 predicted 1241
6 SASI_Hs01_00299641 predicted 2606
7 SASI_Hs01_00299642 predicted 378
8 SASI_Hs01_00299643 predicted 1699
9 SASI_Hs01_00299644 predicted 1296
10 SASI_Hs01_00299645 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250715 predicted 1351
2 SASI_Hs01_00250716 predicted 993
3 SASI_Hs01_00250717 predicted 1532
4 SASI_Hs01_00250718 predicted 1010
5 SASI_Hs01_00250719 predicted 1057
6 SASI_Hs01_00250720 predicted 1391
7 SASI_Hs01_00250721 predicted 1458
8 SASI_Hs01_00250722 predicted 685
9 SASI_Hs01_00250723 predicted 1591
10 SASI_Hs01_00250724 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251870 predicted 3481
2 SASI_Hs01_00251871 predicted 3094
3 SASI_Hs01_00251872 predicted 3109
4 SASI_Hs01_00251873 predicted 3539
5 SASI_Hs01_00251874 predicted 3274
6 SASI_Hs01_00251875 predicted 3890
7 SASI_Hs01_00251876 predicted 3736
8 SASI_Hs01_00251877 predicted 3386
9 SASI_Hs01_00251878 predicted 3381
10 SASI_Hs01_00251879 predicted 3620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271269 predicted 1802
2 SASI_Rn02_00271270 predicted 1894
3 SASI_Rn02_00271271 predicted 3070
4 SASI_Rn02_00271272 predicted 2630
5 SASI_Rn02_00271273 predicted 2003
6 SASI_Rn02_00271274 predicted 2020
7 SASI_Rn02_00271275 predicted 1649
8 SASI_Rn02_00271276 predicted 1667
9 SASI_Rn02_00271277 predicted 3987
10 SASI_Rn02_00271278 predicted 3872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079699 predicted 1975
2 SASI_Mm01_00079700 predicted 1229
3 SASI_Mm01_00079701 predicted 629
4 SASI_Mm01_00079703 predicted 1329
5 SASI_Mm01_00079704 predicted 4096
6 SASI_Mm01_00079705 predicted 510
7 SASI_Mm01_00079706 predicted 4287
8 SASI_Mm01_00079707 predicted 4117
9 SASI_Mm02_00349736 predicted 3978
10 SASI_Mm01_00079708 predicted 494
11 SASI_Mm01_00079702 predicted 2284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012293
VALIDATED
PXDN MISSION shRNA Bacterial Glycerol Stock
peroxidasin homolog (Drosophila)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012293.1-639s21c1
Sequence:CCGGACACACTTCACTGCGACTGTGCTCGAGCACAGTCGCAGTGAAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-1901s21c1
Sequence:CCGGGTTCCTGACGTCAGTCGAAATCTCGAGATTTCGACTGACGTCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-718s21c1
Sequence:CCGGAGCGGCCATCTGTGAATATCCCTCGAGGGATATTCACAGATGGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-620s21c1
Sequence:CCGGAGATTGCGACTGGACTCAAACCTCGAGGTTTGAGTCCAGTCGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012293
VALIDATED
PXDN MISSION shRNA shRNA Plasmid DNA
peroxidasin homolog (Drosophila)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012293.1-639s21c1
Sequence:CCGGACACACTTCACTGCGACTGTGCTCGAGCACAGTCGCAGTGAAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-1901s21c1
Sequence:CCGGGTTCCTGACGTCAGTCGAAATCTCGAGATTTCGACTGACGTCAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-718s21c1
Sequence:CCGGAGCGGCCATCTGTGAATATCCCTCGAGGGATATTCACAGATGGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-620s21c1
Sequence:CCGGAGATTGCGACTGGACTCAAACCTCGAGGTTTGAGTCCAGTCGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012293
VALIDATED
PXDN MISSION shRNA Lentiviral Transduction Particles
peroxidasin homolog (Drosophila)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012293.1-639s21c1
Sequence:CCGGACACACTTCACTGCGACTGTGCTCGAGCACAGTCGCAGTGAAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-1901s21c1
Sequence:CCGGGTTCCTGACGTCAGTCGAAATCTCGAGATTTCGACTGACGTCAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-718s21c1
Sequence:CCGGAGCGGCCATCTGTGAATATCCCTCGAGGGATATTCACAGATGGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012293.1-620s21c1
Sequence:CCGGAGATTGCGACTGGACTCAAACCTCGAGGTTTGAGTCCAGTCGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181395
PXDN MISSION shRNA Bacterial Glycerol Stock
peroxidasin homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-952s21c1
Sequence:CCGGTGAAGACGGACTCTCGCTTAACTCGAGTTAAGCGAGAGTCCGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-2320s21c1
Sequence:CCGGACGATGGCACGTGCAACAATCCTCGAGGATTGTTGCACGTGCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181395.1-4546s21c1
Sequence:CCGGTCGAAGCTGGTCCACAGAATACTCGAGTATTCTGTGGACCAGCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-1588s21c1
Sequence:CCGGATGAGTGCCAGGCCGTCAATACTCGAGTATTGACGGCCTGGCACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4064s1c1
Sequence:CCGGCAATGCTTTCTCCTACCATTTCTCGAGAAATGGTAGGAGAAAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1954s1c1
Sequence:CCGGCCTATGTTGCTACCTCTATTGCTCGAGCAATAGAGGTAGCAACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4148s1c1
Sequence:CCGGGCGGAAAGCACTAAGTGTAAACTCGAGTTTACACTTAGTGCTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-4106s21c1
Sequence:CCGGATTTAGCTATGAGGACGATAACTCGAGTTATCGTCCTCATAGCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181395.1-4557s1c1
Sequence:CCGGCCACAGAATACTTGTGAGCCTCTCGAGAGGCTCACAAGTATTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1815s1c1
Sequence:CCGGGAAGGATTCTTGACCATCAATCTCGAGATTGATGGTCAAGAATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181395
PXDN MISSION shRNA shRNA Plasmid DNA
peroxidasin homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-952s21c1
Sequence:CCGGTGAAGACGGACTCTCGCTTAACTCGAGTTAAGCGAGAGTCCGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-2320s21c1
Sequence:CCGGACGATGGCACGTGCAACAATCCTCGAGGATTGTTGCACGTGCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181395.1-4546s21c1
Sequence:CCGGTCGAAGCTGGTCCACAGAATACTCGAGTATTCTGTGGACCAGCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-1588s21c1
Sequence:CCGGATGAGTGCCAGGCCGTCAATACTCGAGTATTGACGGCCTGGCACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4064s1c1
Sequence:CCGGCAATGCTTTCTCCTACCATTTCTCGAGAAATGGTAGGAGAAAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1954s1c1
Sequence:CCGGCCTATGTTGCTACCTCTATTGCTCGAGCAATAGAGGTAGCAACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4148s1c1
Sequence:CCGGGCGGAAAGCACTAAGTGTAAACTCGAGTTTACACTTAGTGCTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-4106s21c1
Sequence:CCGGATTTAGCTATGAGGACGATAACTCGAGTTATCGTCCTCATAGCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181395.1-4557s1c1
Sequence:CCGGCCACAGAATACTTGTGAGCCTCTCGAGAGGCTCACAAGTATTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1815s1c1
Sequence:CCGGGAAGGATTCTTGACCATCAATCTCGAGATTGATGGTCAAGAATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181395
PXDN MISSION shRNA Lentiviral Transduction Particles
peroxidasin homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-952s21c1
Sequence:CCGGTGAAGACGGACTCTCGCTTAACTCGAGTTAAGCGAGAGTCCGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-2320s21c1
Sequence:CCGGACGATGGCACGTGCAACAATCCTCGAGGATTGTTGCACGTGCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181395.1-4546s21c1
Sequence:CCGGTCGAAGCTGGTCCACAGAATACTCGAGTATTCTGTGGACCAGCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-1588s21c1
Sequence:CCGGATGAGTGCCAGGCCGTCAATACTCGAGTATTGACGGCCTGGCACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4064s1c1
Sequence:CCGGCAATGCTTTCTCCTACCATTTCTCGAGAAATGGTAGGAGAAAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1954s1c1
Sequence:CCGGCCTATGTTGCTACCTCTATTGCTCGAGCAATAGAGGTAGCAACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-4148s1c1
Sequence:CCGGGCGGAAAGCACTAAGTGTAAACTCGAGTTTACACTTAGTGCTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181395.1-4106s21c1
Sequence:CCGGATTTAGCTATGAGGACGATAACTCGAGTTATCGTCCTCATAGCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181395.1-4557s1c1
Sequence:CCGGCCACAGAATACTTGTGAGCCTCTCGAGAGGCTCACAAGTATTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181395.1-1815s1c1
Sequence:CCGGGAAGGATTCTTGACCATCAATCTCGAGATTGATGGTCAAGAATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)