EMAIL THIS PAGE TO A FRIEND

PXK

PX domain containing serine/threonine kinase

114 Gene Product Result for
Synonyms: MONaKA
Gene ID:
Human(54899) Summary: PXK binds to the Na,K-ATPase beta-1 (ATP1B1; MIM 182330) and beta-3 (ATP1B3; MIM 601867) subunits and modulates both Na,K-ATPase enzymatic and ion pump activities (Mao et al., 2005 [PubMed 16135750]
Mouse(218699) PX domain containing serine/threonine kinase
Rat(306203) PX domain containing serine/threonine kinase
Zebrafish(557065) PX domain containing serine/threonine kinase
Horse(100057684) PX domain containing serine/threonine kinase
domestic cat(101100115) PX domain containing serine/threonine kinase
dog(476575) PX domain containing serine/threonine kinase
chicken(416065) PX domain containing serine/threonine kinase
naked mole-rat(101724049) PX domain containing serine/threonine kinase
domestic guinea pig(100733192) PX domain containing serine/threonine kinase
cow(614093) PX domain containing serine/threonine kinase
sheep(101108429) PX domain containing serine/threonine kinase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017771 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017771 Rosetta Predictions human pricing
NM_182821 Rosetta Predictions rat pricing
NM_145458 Rosetta Predictions mouse pricing
NM_178279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214278 predicted 745
2 SASI_Hs01_00214280 predicted 399
3 SASI_Hs01_00214281 predicted 296
4 SASI_Hs02_00350608 predicted 1110
5 SASI_Hs02_00350609 predicted 552
6 SASI_Hs01_00214283 predicted 730
7 SASI_Hs01_00214284 predicted 933
8 SASI_Hs01_00214285 predicted 1223
9 SASI_Hs01_00214286 predicted 644
10 SASI_Hs01_00214287 predicted 261
11 SASI_Hs01_00214279 predicted 252
12 SASI_Hs01_00214282 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115907 predicted 1253
2 SASI_Rn01_00115909 predicted 1383
3 SASI_Rn01_00115910 predicted 873
4 SASI_Rn02_00269849 predicted 1049
5 SASI_Rn01_00115911 predicted 636
6 SASI_Rn01_00115912 predicted 1032
7 SASI_Rn01_00115913 predicted 1295
8 SASI_Rn01_00115914 predicted 918
9 SASI_Rn01_00115915 predicted 385
10 SASI_Rn01_00115916 predicted 883
11 SASI_Rn01_00115908 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055152 predicted 1242
2 SASI_Mm02_00340849 predicted 1317
3 SASI_Mm01_00055153 predicted 1333
4 SASI_Mm01_00055154 predicted 1167
5 SASI_Mm01_00055155 predicted 1084
6 SASI_Mm01_00055156 predicted 1179
7 SASI_Mm01_00055157 predicted 1241
8 SASI_Mm01_00055158 predicted 1135
9 SASI_Mm01_00055159 predicted 1355
10 SASI_Mm01_00055160 predicted 1022
11 SASI_Mm01_00055161 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083365 predicted 1173
2 SASI_Mm02_00348726 predicted 1250
3 SASI_Mm01_00083366 predicted 1263
4 SASI_Mm01_00083367 predicted 1095
5 SASI_Mm01_00083368 predicted 1013
6 SASI_Mm01_00083369 predicted 1105
7 SASI_Mm01_00083370 predicted 1171
8 SASI_Mm01_00083371 predicted 1069
9 SASI_Mm01_00083372 predicted 1283
10 SASI_Mm01_00083373 predicted 945
11 SASI_Mm01_00083374 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145458
VALIDATED
PXK MISSION shRNA Bacterial Glycerol Stock
PX domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2085s21c1
Sequence:CCGGGCAGCACTGTTTGGGTATTATCTCGAGATAATACCCAAACAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-192s21c1
Sequence:CCGGGCAGTCGCACACGGAATATATCTCGAGATATATTCCGTGTGCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2186s21c1
Sequence:CCGGCCGTCCTTCCCACTCTATTATCTCGAGATAATAGAGTGGGAAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-228s1c1
Sequence:CCGGCGTCAGAAGATACAGCGACTTCTCGAGAAGTCGCTGTATCTTCTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145458.1-1023s1c1
Sequence:CCGGCCGATCCTACTTCACACAATTCTCGAGAATTGTGTGAAGTAGGATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-432s1c1
Sequence:CCGGCCCAAACAACTATTCTGCAAACTCGAGTTTGCAGAATAGTTGTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-880s1c1
Sequence:CCGGCGGCAGATATTAGAGGCACTACTCGAGTAGTGCCTCTAATATCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-1740s1c1
Sequence:CCGGGCTCAGTTCCATCCAGAATTTCTCGAGAAATTCTGGATGGAACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145458
VALIDATED
PXK MISSION shRNA shRNA Plasmid DNA
PX domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2085s21c1
Sequence:CCGGGCAGCACTGTTTGGGTATTATCTCGAGATAATACCCAAACAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-192s21c1
Sequence:CCGGGCAGTCGCACACGGAATATATCTCGAGATATATTCCGTGTGCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2186s21c1
Sequence:CCGGCCGTCCTTCCCACTCTATTATCTCGAGATAATAGAGTGGGAAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-228s1c1
Sequence:CCGGCGTCAGAAGATACAGCGACTTCTCGAGAAGTCGCTGTATCTTCTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145458.1-1023s1c1
Sequence:CCGGCCGATCCTACTTCACACAATTCTCGAGAATTGTGTGAAGTAGGATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-432s1c1
Sequence:CCGGCCCAAACAACTATTCTGCAAACTCGAGTTTGCAGAATAGTTGTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-880s1c1
Sequence:CCGGCGGCAGATATTAGAGGCACTACTCGAGTAGTGCCTCTAATATCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-1740s1c1
Sequence:CCGGGCTCAGTTCCATCCAGAATTTCTCGAGAAATTCTGGATGGAACTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145458
VALIDATED
PXK MISSION shRNA Lentiviral Transduction Particles
PX domain containing serine/threonine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2085s21c1
Sequence:CCGGGCAGCACTGTTTGGGTATTATCTCGAGATAATACCCAAACAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-192s21c1
Sequence:CCGGGCAGTCGCACACGGAATATATCTCGAGATATATTCCGTGTGCGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145458.3-2186s21c1
Sequence:CCGGCCGTCCTTCCCACTCTATTATCTCGAGATAATAGAGTGGGAAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-228s1c1
Sequence:CCGGCGTCAGAAGATACAGCGACTTCTCGAGAAGTCGCTGTATCTTCTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145458.1-1023s1c1
Sequence:CCGGCCGATCCTACTTCACACAATTCTCGAGAATTGTGTGAAGTAGGATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-432s1c1
Sequence:CCGGCCCAAACAACTATTCTGCAAACTCGAGTTTGCAGAATAGTTGTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-880s1c1
Sequence:CCGGCGGCAGATATTAGAGGCACTACTCGAGTAGTGCCTCTAATATCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145458.1-1740s1c1
Sequence:CCGGGCTCAGTTCCATCCAGAATTTCTCGAGAAATTCTGGATGGAACTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017771
VALIDATED
PXK MISSION shRNA Bacterial Glycerol Stock
PX domain containing serine/threonine kinase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-764s1c1
Sequence:CCGGCGTTGCTAATTAGGATGTTTACTCGAGTAAACATCCTAATTAGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-1264s1c1
Sequence:CCGGCGGCTCTTACAGATGCCATTACTCGAGTAATGGCATCTGTAAGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1542s1c1
Sequence:CCGGGTACAGCAACTCCAATAATTCCTCGAGGAATTATTGGAGTTGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1838s1c1
Sequence:CCGGGCTTCCTGTTTACACTTGGAGCTCGAGCTCCAAGTGTAAACAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-686s1c1
Sequence:CCGGGTCTAATCAAACTTCTGCCTTCTCGAGAAGGCAGAAGTTTGATTAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-472s1c1
Sequence:CCGGTCCGCAAACTATACTGAGATTCTCGAGAATCTCAGTATAGTTTGCGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1318s1c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1038s21c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1038s1c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017771.2-1897s1c1
Sequence:CCGGCAAACTACCCTCTTCCTGGGACTCGAGTCCCAGGAAGAGGGTAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-200s1c1
Sequence:CCGGCGGAATATATTATTCGAGTGCCTCGAGGCACTCGAATAATATATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1937s1c1
Sequence:CCGGACAGCCACAAACAGTACTATTCTCGAGAATAGTACTGTTTGTGGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1318s21c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017771
VALIDATED
PXK MISSION shRNA shRNA Plasmid DNA
PX domain containing serine/threonine kinase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-764s1c1
Sequence:CCGGCGTTGCTAATTAGGATGTTTACTCGAGTAAACATCCTAATTAGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-1264s1c1
Sequence:CCGGCGGCTCTTACAGATGCCATTACTCGAGTAATGGCATCTGTAAGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1542s1c1
Sequence:CCGGGTACAGCAACTCCAATAATTCCTCGAGGAATTATTGGAGTTGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1838s1c1
Sequence:CCGGGCTTCCTGTTTACACTTGGAGCTCGAGCTCCAAGTGTAAACAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-686s1c1
Sequence:CCGGGTCTAATCAAACTTCTGCCTTCTCGAGAAGGCAGAAGTTTGATTAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-472s1c1
Sequence:CCGGTCCGCAAACTATACTGAGATTCTCGAGAATCTCAGTATAGTTTGCGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1318s1c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1038s21c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1038s1c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017771.2-1897s1c1
Sequence:CCGGCAAACTACCCTCTTCCTGGGACTCGAGTCCCAGGAAGAGGGTAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-200s1c1
Sequence:CCGGCGGAATATATTATTCGAGTGCCTCGAGGCACTCGAATAATATATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1937s1c1
Sequence:CCGGACAGCCACAAACAGTACTATTCTCGAGAATAGTACTGTTTGTGGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1318s21c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017771
VALIDATED
PXK MISSION shRNA Lentiviral Transduction Particles
PX domain containing serine/threonine kinase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-764s1c1
Sequence:CCGGCGTTGCTAATTAGGATGTTTACTCGAGTAAACATCCTAATTAGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-1264s1c1
Sequence:CCGGCGGCTCTTACAGATGCCATTACTCGAGTAATGGCATCTGTAAGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1542s1c1
Sequence:CCGGGTACAGCAACTCCAATAATTCCTCGAGGAATTATTGGAGTTGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.2-1838s1c1
Sequence:CCGGGCTTCCTGTTTACACTTGGAGCTCGAGCTCCAAGTGTAAACAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-686s1c1
Sequence:CCGGGTCTAATCAAACTTCTGCCTTCTCGAGAAGGCAGAAGTTTGATTAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-472s1c1
Sequence:CCGGTCCGCAAACTATACTGAGATTCTCGAGAATCTCAGTATAGTTTGCGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1318s1c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1038s21c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1038s1c1
Sequence:CCGGGCCTTCCTTCTACCGATCTTACTCGAGTAAGATCGGTAGAAGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017771.2-1897s1c1
Sequence:CCGGCAAACTACCCTCTTCCTGGGACTCGAGTCCCAGGAAGAGGGTAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017771.2-200s1c1
Sequence:CCGGCGGAATATATTATTCGAGTGCCTCGAGGCACTCGAATAATATATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017771.x-1937s1c1
Sequence:CCGGACAGCCACAAACAGTACTATTCTCGAGAATAGTACTGTTTGTGGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017771.3-1318s21c1
Sequence:CCGGCCACAGTTTAAGATCCCTACACTCGAGTGTAGGGATCTTAAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)