EMAIL THIS PAGE TO A FRIEND

PXMP2

peroxisomal membrane protein 2, 22kDa

123 Gene Product Result for
Synonyms: PMP22
UniProtKB ID: Q9NR77
Gene ID:
Mouse(19301) peroxisomal membrane protein 2
Rat(29533) peroxisomal membrane protein 2
Zebrafish(447868) peroxisomal membrane protein 2
domestic cat(101093966) peroxisomal membrane protein 2, 22kDa
dog(486222) peroxisomal membrane protein 2, 22kDa
cow(508609) peroxisomal membrane protein 2, 22kDa
sheep(101115907) peroxisomal membrane protein 2, 22kDa
domestic guinea pig(100726507) peroxisomal membrane protein 2, 22kDa
naked mole-rat(101703929) peroxisomal membrane protein 2, 22kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301744 ANTI-PXMP2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4300933 Anti-PXMP2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036841 MISSION® esiRNA esiRNA human PXMP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018663 Rosetta Predictions human pricing
XM_001713955 Rosetta Predictions human pricing
NM_031587 Rosetta Predictions rat pricing
NM_008993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068919 predicted 532
2 SASI_Hs01_00068920 predicted 611
3 SASI_Hs01_00068921 predicted 542
4 SASI_Hs01_00068922 predicted 285
5 SASI_Hs01_00068923 predicted 729
6 SASI_Hs01_00068924 predicted 539
7 SASI_Hs01_00068925 predicted 218
8 SASI_Hs01_00068926 predicted 262
9 SASI_Hs01_00068927 predicted 567
10 SASI_Hs01_00068928 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394054 predicted 746
2 SASI_Hs02_00394055 predicted 951
3 SASI_Hs02_00394056 predicted 752
4 SASI_Hs02_00394057 predicted 496
5 SASI_Hs02_00394058 predicted 1074
6 SASI_Hs02_00394059 predicted 748
7 SASI_Hs02_00394060 predicted 436
8 SASI_Hs02_00394061 predicted 470
9 SASI_Hs02_00394062 predicted 494
10 SASI_Hs02_00394063 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098952 predicted 375
2 SASI_Rn01_00098954 predicted 264
3 SASI_Rn01_00098955 predicted 486
4 SASI_Rn01_00098956 predicted 487
5 SASI_Rn01_00098957 predicted 225
6 SASI_Rn01_00098958 predicted 233
7 SASI_Rn01_00098959 predicted 279
8 SASI_Rn02_00264856 predicted 476
9 SASI_Rn01_00098960 predicted 209
10 SASI_Rn02_00264857 predicted 429
11 SASI_Rn01_00098953 predicted 556
12 SASI_Rn01_00098961 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315091 predicted 702
2 SASI_Mm02_00315092 predicted 597
3 SASI_Mm01_00142479 predicted 514
4 SASI_Mm01_00142480 predicted 424
5 SASI_Mm02_00315093 predicted 565
6 SASI_Mm01_00142483 predicted 385
7 SASI_Mm01_00142485 predicted 483
8 SASI_Mm02_00315094 predicted 697
9 SASI_Mm01_00142487 predicted 419
10 SASI_Mm02_00315095 predicted 634
11 SASI_Mm01_00142478 predicted 201
12 SASI_Mm01_00142481 predicted 256
13 SASI_Mm01_00142482 predicted 215
14 SASI_Mm01_00142484 predicted 324
15 SASI_Mm01_00142486 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018663
VALIDATED
PXMP2 MISSION shRNA Bacterial Glycerol Stock
peroxisomal membrane protein 2, 22kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-323s1c1
Sequence:CCGGGAGTCACTTCTTCTACTTCTTCTCGAGAAGAAGTAGAAGAAGTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-552s1c1
Sequence:CCGGCAGTTCATCAACATCAACTACCTCGAGGTAGTTGATGTTGATGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-428s1c1
Sequence:CCGGCCTCATGTTGTTCTTCCTCATCTCGAGATGAGGAAGAACAACATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-808s1c1
Sequence:CCGGGAATGTCAGAACCCTGTCTTTCTCGAGAAAGACAGGGTTCTGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018663.1-791s1c1
Sequence:CCGGGAGAAACAGAAATCTCTGAATCTCGAGATTCAGAGATTTCTGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018663.1-542s1c1
Sequence:CCGGGACGCCACTACAGTTCATCAACTCGAGTTGATGAACTGTAGTGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-211s21c1
Sequence:CCGGACTTCCTGGCCCAGATGATTGCTCGAGCAATCATCTGGGCCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018663.1-607s21c1
Sequence:CCGGTGGCAGCTCTGTTCTGGTATGCTCGAGCATACCAGAACAGAGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-738s21c1
Sequence:CCGGGGATGTCACTGACTCTAAATCCTCGAGGATTTAGAGTCAGTGACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-548s21c1
Sequence:CCGGACTACAGTTCATCAACATCAACTCGAGTTGATGTTGATGAACTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-278s21c1
Sequence:CCGGGCCTCTGAGATATGCCGTTTACTCGAGTAAACGGCATATCTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018663
VALIDATED
PXMP2 MISSION shRNA shRNA Plasmid DNA
peroxisomal membrane protein 2, 22kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-323s1c1
Sequence:CCGGGAGTCACTTCTTCTACTTCTTCTCGAGAAGAAGTAGAAGAAGTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-552s1c1
Sequence:CCGGCAGTTCATCAACATCAACTACCTCGAGGTAGTTGATGTTGATGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-428s1c1
Sequence:CCGGCCTCATGTTGTTCTTCCTCATCTCGAGATGAGGAAGAACAACATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-808s1c1
Sequence:CCGGGAATGTCAGAACCCTGTCTTTCTCGAGAAAGACAGGGTTCTGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018663.1-791s1c1
Sequence:CCGGGAGAAACAGAAATCTCTGAATCTCGAGATTCAGAGATTTCTGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018663.1-542s1c1
Sequence:CCGGGACGCCACTACAGTTCATCAACTCGAGTTGATGAACTGTAGTGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-211s21c1
Sequence:CCGGACTTCCTGGCCCAGATGATTGCTCGAGCAATCATCTGGGCCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018663.1-607s21c1
Sequence:CCGGTGGCAGCTCTGTTCTGGTATGCTCGAGCATACCAGAACAGAGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-738s21c1
Sequence:CCGGGGATGTCACTGACTCTAAATCCTCGAGGATTTAGAGTCAGTGACATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-548s21c1
Sequence:CCGGACTACAGTTCATCAACATCAACTCGAGTTGATGTTGATGAACTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-278s21c1
Sequence:CCGGGCCTCTGAGATATGCCGTTTACTCGAGTAAACGGCATATCTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018663
VALIDATED
PXMP2 MISSION shRNA Lentiviral Transduction Particles
peroxisomal membrane protein 2, 22kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-323s1c1
Sequence:CCGGGAGTCACTTCTTCTACTTCTTCTCGAGAAGAAGTAGAAGAAGTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-552s1c1
Sequence:CCGGCAGTTCATCAACATCAACTACCTCGAGGTAGTTGATGTTGATGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-428s1c1
Sequence:CCGGCCTCATGTTGTTCTTCCTCATCTCGAGATGAGGAAGAACAACATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018663.1-808s1c1
Sequence:CCGGGAATGTCAGAACCCTGTCTTTCTCGAGAAAGACAGGGTTCTGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018663.1-791s1c1
Sequence:CCGGGAGAAACAGAAATCTCTGAATCTCGAGATTCAGAGATTTCTGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018663.1-542s1c1
Sequence:CCGGGACGCCACTACAGTTCATCAACTCGAGTTGATGAACTGTAGTGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-211s21c1
Sequence:CCGGACTTCCTGGCCCAGATGATTGCTCGAGCAATCATCTGGGCCAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018663.1-607s21c1
Sequence:CCGGTGGCAGCTCTGTTCTGGTATGCTCGAGCATACCAGAACAGAGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-738s21c1
Sequence:CCGGGGATGTCACTGACTCTAAATCCTCGAGGATTTAGAGTCAGTGACATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-548s21c1
Sequence:CCGGACTACAGTTCATCAACATCAACTCGAGTTGATGTTGATGAACTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018663.1-278s21c1
Sequence:CCGGGCCTCTGAGATATGCCGTTTACTCGAGTAAACGGCATATCTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008993
VALIDATED
PXMP2 MISSION shRNA Bacterial Glycerol Stock
peroxisomal membrane protein 2, 22kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000097634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-205s1c1
Sequence:CCGGAGTGGGCTTCTCAGATATTTACTCGAGTAAATATCTGAGAAGCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-67s1c1
Sequence:CCGGGCCCAATACTTGCTGCTCCTACTCGAGTAGGAGCAGCAAGTATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-255s1c1
Sequence:CCGGGAGTCACTACCTCTACCTCTTCTCGAGAAGAGGTAGAGGTAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-366s1c1
Sequence:CCGGGCTGTTCTTCTTCGTCATGAACTCGAGTTCATGACGAAGAAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008993
VALIDATED
PXMP2 MISSION shRNA shRNA Plasmid DNA
peroxisomal membrane protein 2, 22kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000097634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-205s1c1
Sequence:CCGGAGTGGGCTTCTCAGATATTTACTCGAGTAAATATCTGAGAAGCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-67s1c1
Sequence:CCGGGCCCAATACTTGCTGCTCCTACTCGAGTAGGAGCAGCAAGTATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-255s1c1
Sequence:CCGGGAGTCACTACCTCTACCTCTTCTCGAGAAGAGGTAGAGGTAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-366s1c1
Sequence:CCGGGCTGTTCTTCTTCGTCATGAACTCGAGTTCATGACGAAGAAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008993
VALIDATED
PXMP2 MISSION shRNA Lentiviral Transduction Particles
peroxisomal membrane protein 2, 22kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000097634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-205s1c1
Sequence:CCGGAGTGGGCTTCTCAGATATTTACTCGAGTAAATATCTGAGAAGCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-67s1c1
Sequence:CCGGGCCCAATACTTGCTGCTCCTACTCGAGTAGGAGCAGCAAGTATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-255s1c1
Sequence:CCGGGAGTCACTACCTCTACCTCTTCTCGAGAAGAGGTAGAGGTAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008993.1-366s1c1
Sequence:CCGGGCTGTTCTTCTTCGTCATGAACTCGAGTTCATGACGAAGAAGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)