EMAIL THIS PAGE TO A FRIEND

PXMP4

peroxisomal membrane protein 4, 24kDa

91 Gene Product Result for
Synonyms: PMP24
UniProtKB ID: Q9Y6I8, A2A2I7, Q9H0T4
Gene ID:
Mouse(59038) peroxisomal membrane protein 4
Rat(282634) peroxisomal membrane protein 4
naked mole-rat(101716948) peroxisomal membrane protein 4, 24kDa
domestic guinea pig(100733213) peroxisomal membrane protein 4, 24kDa
cow(617160) peroxisomal membrane protein 4, 24kDa
sheep(101110957) peroxisomal membrane protein 4, 24kDa
chicken(419153) peroxisomal membrane protein 4, 24kDa
dog(610008) peroxisomal membrane protein 4, 24kDa
domestic cat(101098216) peroxisomal membrane protein 4, 24kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA050077 Anti-PXMP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132921 MISSION® esiRNA esiRNA human PXMP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007238 Rosetta Predictions human pricing
NM_183397 Rosetta Predictions human pricing
NM_172223 Rosetta Predictions rat pricing
NM_021534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036627 predicted 715
2 SASI_Hs01_00036629 predicted 714
3 SASI_Hs01_00036631 predicted 718
4 SASI_Hs01_00036632 predicted 737
5 SASI_Hs01_00036633 predicted 712
6 SASI_Hs01_00036635 predicted 693
7 SASI_Hs01_00036634 predicted 708
8 SASI_Hs02_00343249 predicted 316
9 SASI_Hs02_00343250 predicted 188
10 SASI_Hs02_00343251 predicted 140
11 SASI_Hs01_00036626 predicted 668
12 SASI_Hs01_00036628 predicted 690
13 SASI_Hs01_00036630 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196041 predicted 514
2 SASI_Hs01_00196043 predicted 521
3 SASI_Hs01_00196045 predicted 524
4 SASI_Hs01_00196046 predicted 535
5 SASI_Hs01_00196047 predicted 515
6 SASI_Hs01_00196049 predicted 497
7 SASI_Hs01_00196048 predicted 503
8 SASI_Hs02_00371302 predicted 478
9 SASI_Hs02_00371303 predicted 189
10 SASI_Hs02_00371304 predicted 137
11 SASI_Hs01_00196040 predicted 471
12 SASI_Hs01_00196042 predicted 492
13 SASI_Hs01_00196044 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086683 predicted 803
2 SASI_Rn01_00086684 predicted 475
3 SASI_Rn01_00086685 predicted 382
4 SASI_Rn01_00086686 predicted 429
5 SASI_Rn01_00086687 predicted 381
6 SASI_Rn01_00086688 predicted 748
7 SASI_Rn01_00086689 predicted 373
8 SASI_Rn02_00269196 predicted 567
9 SASI_Rn02_00269197 predicted 634
10 SASI_Rn01_00086690 predicted 258
11 SASI_Rn01_00086682 predicted 779
12 SASI_Rn01_00086691 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145272 predicted 312
2 SASI_Mm01_00145273 predicted 757
3 SASI_Mm01_00145274 predicted 906
4 SASI_Mm01_00145275 predicted 812
5 SASI_Mm01_00145276 predicted 390
6 SASI_Mm01_00145277 predicted 377
7 SASI_Mm01_00145278 predicted 809
8 SASI_Mm02_00326272 predicted 376
9 SASI_Mm01_00145279 predicted 477
10 SASI_Mm01_00145280 predicted 281
11 SASI_Mm01_00145281 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007238
VALIDATED
PXMP4 MISSION shRNA Bacterial Glycerol Stock
peroxisomal membrane protein 4, 24kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007238.4-818s21c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-721s21c1
Sequence:CCGGTCAGACTTCCTCGTCTATAACCTCGAGGTTATAGACGAGGAAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007238.3-1104s1c1
Sequence:CCGGGCAGTGGGTTGTAAATACTTTCTCGAGAAAGTATTTACAACCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-299s1c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-360s21c1
Sequence:CCGGACGGTTTGTGTTCACCTACAACTCGAGTTGTAGGTGAACACAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007238.4-332s21c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-743s21c1
Sequence:CCGGAGAGCCGTCCCTCCAATTAATCTCGAGATTAATTGGAGGGACGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-785s1c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-462s1c1
Sequence:CCGGCCAGATCAACATGTACCTGTTCTCGAGAACAGGTACATGTTGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-666s1c1
Sequence:CCGGCAGCAATGTATGGCACGACATCTCGAGATGTCGTGCCATACATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007238
VALIDATED
PXMP4 MISSION shRNA shRNA Plasmid DNA
peroxisomal membrane protein 4, 24kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007238.4-818s21c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-721s21c1
Sequence:CCGGTCAGACTTCCTCGTCTATAACCTCGAGGTTATAGACGAGGAAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007238.3-1104s1c1
Sequence:CCGGGCAGTGGGTTGTAAATACTTTCTCGAGAAAGTATTTACAACCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-299s1c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-360s21c1
Sequence:CCGGACGGTTTGTGTTCACCTACAACTCGAGTTGTAGGTGAACACAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007238.4-332s21c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-743s21c1
Sequence:CCGGAGAGCCGTCCCTCCAATTAATCTCGAGATTAATTGGAGGGACGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-785s1c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-462s1c1
Sequence:CCGGCCAGATCAACATGTACCTGTTCTCGAGAACAGGTACATGTTGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-666s1c1
Sequence:CCGGCAGCAATGTATGGCACGACATCTCGAGATGTCGTGCCATACATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007238
VALIDATED
PXMP4 MISSION shRNA Lentiviral Transduction Particles
peroxisomal membrane protein 4, 24kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007238.4-818s21c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-721s21c1
Sequence:CCGGTCAGACTTCCTCGTCTATAACCTCGAGGTTATAGACGAGGAAGTCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007238.3-1104s1c1
Sequence:CCGGGCAGTGGGTTGTAAATACTTTCTCGAGAAAGTATTTACAACCCACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-299s1c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-360s21c1
Sequence:CCGGACGGTTTGTGTTCACCTACAACTCGAGTTGTAGGTGAACACAAACCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007238.4-332s21c1
Sequence:CCGGCCACATATATCCACTCCTGGACTCGAGTCCAGGAGTGGATATATGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007238.4-743s21c1
Sequence:CCGGAGAGCCGTCCCTCCAATTAATCTCGAGATTAATTGGAGGGACGGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-785s1c1
Sequence:CCGGCAAAGGATACTGCCTTCTCAACTCGAGTTGAGAAGGCAGTATCCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007238.3-462s1c1
Sequence:CCGGCCAGATCAACATGTACCTGTTCTCGAGAACAGGTACATGTTGATCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007238.3-666s1c1
Sequence:CCGGCAGCAATGTATGGCACGACATCTCGAGATGTCGTGCCATACATTGCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021534
PXMP4 MISSION shRNA Bacterial Glycerol Stock
peroxisomal membrane protein 4, 24kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-123s1c1
Sequence:CCGGGCTGGCCGTGATAAAGGGCTTCTCGAGAAGCCCTTTATCACGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021534.2-796s1c1
Sequence:CCGGGCCTGCCTTCTCAAAGTCATACTCGAGTATGACTTTGAGAAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-280s1c1
Sequence:CCGGGCCTGCTTTGTGTTTGCCTATCTCGAGATAGGCAAACACAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-242s1c1
Sequence:CCGGCCATTCTGAAAGCCACGTACACTCGAGTGTACGTGGCTTTCAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-384s1c1
Sequence:CCGGCCTGCTGTTTGGAGAGAACAACTCGAGTTGTTCTCTCCAAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021534
PXMP4 MISSION shRNA shRNA Plasmid DNA
peroxisomal membrane protein 4, 24kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-123s1c1
Sequence:CCGGGCTGGCCGTGATAAAGGGCTTCTCGAGAAGCCCTTTATCACGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021534.2-796s1c1
Sequence:CCGGGCCTGCCTTCTCAAAGTCATACTCGAGTATGACTTTGAGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-280s1c1
Sequence:CCGGGCCTGCTTTGTGTTTGCCTATCTCGAGATAGGCAAACACAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-242s1c1
Sequence:CCGGCCATTCTGAAAGCCACGTACACTCGAGTGTACGTGGCTTTCAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-384s1c1
Sequence:CCGGCCTGCTGTTTGGAGAGAACAACTCGAGTTGTTCTCTCCAAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021534
PXMP4 MISSION shRNA Lentiviral Transduction Particles
peroxisomal membrane protein 4, 24kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-123s1c1
Sequence:CCGGGCTGGCCGTGATAAAGGGCTTCTCGAGAAGCCCTTTATCACGGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021534.2-796s1c1
Sequence:CCGGGCCTGCCTTCTCAAAGTCATACTCGAGTATGACTTTGAGAAGGCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-280s1c1
Sequence:CCGGGCCTGCTTTGTGTTTGCCTATCTCGAGATAGGCAAACACAAAGCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-242s1c1
Sequence:CCGGCCATTCTGAAAGCCACGTACACTCGAGTGTACGTGGCTTTCAGAATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021534.2-384s1c1
Sequence:CCGGCCTGCTGTTTGGAGAGAACAACTCGAGTTGTTCTCTCCAAACAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???