EMAIL THIS PAGE TO A FRIEND

PXT1

peroxisomal, testis specific 1

60 Gene Product Result for
Synonyms: STEPP
UniProtKB ID: Q8NFP0
Gene ID:
Mouse(69307) peroxisomal, testis specific 1
Rat(100360640) peroxisomal, testis specific 1
cow(100335790) peroxisomal, testis specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057831 MISSION® esiRNA esiRNA targeting mouse Pxt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152990 Rosetta Predictions human pricing
NM_153390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091445 predicted 473
2 SASI_Hs01_00091446 predicted 340
3 SASI_Hs01_00091447 predicted 384
4 SASI_Hs01_00091448 predicted 367
5 SASI_Hs01_00091449 predicted 399
6 SASI_Hs01_00091450 predicted 519
7 SASI_Hs01_00091451 predicted 656
8 SASI_Hs01_00091452 predicted 525
9 SASI_Hs01_00091453 predicted 481
10 SASI_Hs01_00091454 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152649 predicted 270
2 SASI_Mm01_00152650 predicted 418
3 SASI_Mm01_00152651 predicted 333
4 SASI_Mm01_00152652 predicted 298
5 SASI_Mm01_00152653 predicted 419
6 SASI_Mm01_00152654 predicted 315
7 SASI_Mm01_00152655 predicted 346
8 SASI_Mm01_00152656 predicted 619
9 SASI_Mm01_00152657 predicted 301
10 SASI_Mm01_00152658 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152990
PXT1 MISSION shRNA Bacterial Glycerol Stock
peroxisomal, testis specific 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-547s21c1
Sequence:CCGGAGTAACACATTGTTGCAAATCCTCGAGGATTTGCAACAATGTGTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-763s1c1
Sequence:CCGGCATCTCATCTACCTTCCCATTCTCGAGAATGGGAAGGTAGATGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-1039s1c1
Sequence:CCGGCCTGCCTTCTAGAAGAATGTACTCGAGTACATTCTTCTAGAAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-99s1c1
Sequence:CCGGCAGAGATGCACTAGATCATTTCTCGAGAAATGATCTAGTGCATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-98s1c1
Sequence:CCGGGCAGAGATGCACTAGATCATTCTCGAGAATGATCTAGTGCATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-649s21c1
Sequence:CCGGCCCAGATCATAATCTACTTTCCTCGAGGAAAGTAGATTATGATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-132s1c1
Sequence:CCGGCTTTAGAAGAGTTCAGGTGTTCTCGAGAACACCTGAACTCTTCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-77s1c1
Sequence:CCGGGAGAGGATCTTCAACAGGATGCTCGAGCATCCTGTTGAAGATCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-699s21c1
Sequence:CCGGAGCATCACCAGGAGGAAATAACTCGAGTTATTTCCTCCTGGTGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-508s1c1
Sequence:CCGGCCTTCCAGGAATGAAAGAGAACTCGAGTTCTCTTTCATTCCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-82s1c1
Sequence:CCGGGATCTTCAACAGGATGGCAGACTCGAGTCTGCCATCCTGTTGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152990
PXT1 MISSION shRNA shRNA Plasmid DNA
peroxisomal, testis specific 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-547s21c1
Sequence:CCGGAGTAACACATTGTTGCAAATCCTCGAGGATTTGCAACAATGTGTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-763s1c1
Sequence:CCGGCATCTCATCTACCTTCCCATTCTCGAGAATGGGAAGGTAGATGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-1039s1c1
Sequence:CCGGCCTGCCTTCTAGAAGAATGTACTCGAGTACATTCTTCTAGAAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-99s1c1
Sequence:CCGGCAGAGATGCACTAGATCATTTCTCGAGAAATGATCTAGTGCATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-98s1c1
Sequence:CCGGGCAGAGATGCACTAGATCATTCTCGAGAATGATCTAGTGCATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-649s21c1
Sequence:CCGGCCCAGATCATAATCTACTTTCCTCGAGGAAAGTAGATTATGATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-132s1c1
Sequence:CCGGCTTTAGAAGAGTTCAGGTGTTCTCGAGAACACCTGAACTCTTCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-77s1c1
Sequence:CCGGGAGAGGATCTTCAACAGGATGCTCGAGCATCCTGTTGAAGATCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-699s21c1
Sequence:CCGGAGCATCACCAGGAGGAAATAACTCGAGTTATTTCCTCCTGGTGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-508s1c1
Sequence:CCGGCCTTCCAGGAATGAAAGAGAACTCGAGTTCTCTTTCATTCCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-82s1c1
Sequence:CCGGGATCTTCAACAGGATGGCAGACTCGAGTCTGCCATCCTGTTGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152990
PXT1 MISSION shRNA Lentiviral Transduction Particles
peroxisomal, testis specific 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-547s21c1
Sequence:CCGGAGTAACACATTGTTGCAAATCCTCGAGGATTTGCAACAATGTGTTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-763s1c1
Sequence:CCGGCATCTCATCTACCTTCCCATTCTCGAGAATGGGAAGGTAGATGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-1039s1c1
Sequence:CCGGCCTGCCTTCTAGAAGAATGTACTCGAGTACATTCTTCTAGAAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-99s1c1
Sequence:CCGGCAGAGATGCACTAGATCATTTCTCGAGAAATGATCTAGTGCATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-98s1c1
Sequence:CCGGGCAGAGATGCACTAGATCATTCTCGAGAATGATCTAGTGCATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-649s21c1
Sequence:CCGGCCCAGATCATAATCTACTTTCCTCGAGGAAAGTAGATTATGATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-132s1c1
Sequence:CCGGCTTTAGAAGAGTTCAGGTGTTCTCGAGAACACCTGAACTCTTCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-77s1c1
Sequence:CCGGGAGAGGATCTTCAACAGGATGCTCGAGCATCCTGTTGAAGATCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152990.3-699s21c1
Sequence:CCGGAGCATCACCAGGAGGAAATAACTCGAGTTATTTCCTCCTGGTGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152990.2-508s1c1
Sequence:CCGGCCTTCCAGGAATGAAAGAGAACTCGAGTTCTCTTTCATTCCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152990.2-82s1c1
Sequence:CCGGGATCTTCAACAGGATGGCAGACTCGAGTCTGCCATCCTGTTGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153390
PXT1 MISSION shRNA Bacterial Glycerol Stock
peroxisomal, testis specific 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-278s1c1
Sequence:CCGGCTGGAACAACCATTTGCTGTACTCGAGTACAGCAAATGGTTGTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-408s1c1
Sequence:CCGGGCCCTTTGATCCTGCATTTATCTCGAGATAAATGCAGGATCAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-171s1c1
Sequence:CCGGGTCAATCACAGGGTGATTCAGCTCGAGCTGAATCACCCTGTGATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-585s1c1
Sequence:CCGGCCACCTGTTCCTGGTCTATTTCTCGAGAAATAGACCAGGAACAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-431s1c1
Sequence:CCGGCCTGTATCTAGATCTTCATTACTCGAGTAATGAAGATCTAGATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-185s1c1
Sequence:CCGGGATTCAGGAGCATCTTGCACACTCGAGTGTGCAAGATGCTCCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-447s1c1
Sequence:CCGGCATTAAGAACCAACTTCATTACTCGAGTAATGAAGTTGGTTCTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153390
PXT1 MISSION shRNA shRNA Plasmid DNA
peroxisomal, testis specific 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-278s1c1
Sequence:CCGGCTGGAACAACCATTTGCTGTACTCGAGTACAGCAAATGGTTGTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-408s1c1
Sequence:CCGGGCCCTTTGATCCTGCATTTATCTCGAGATAAATGCAGGATCAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-171s1c1
Sequence:CCGGGTCAATCACAGGGTGATTCAGCTCGAGCTGAATCACCCTGTGATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-585s1c1
Sequence:CCGGCCACCTGTTCCTGGTCTATTTCTCGAGAAATAGACCAGGAACAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-431s1c1
Sequence:CCGGCCTGTATCTAGATCTTCATTACTCGAGTAATGAAGATCTAGATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-185s1c1
Sequence:CCGGGATTCAGGAGCATCTTGCACACTCGAGTGTGCAAGATGCTCCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-447s1c1
Sequence:CCGGCATTAAGAACCAACTTCATTACTCGAGTAATGAAGTTGGTTCTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153390
PXT1 MISSION shRNA Lentiviral Transduction Particles
peroxisomal, testis specific 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-278s1c1
Sequence:CCGGCTGGAACAACCATTTGCTGTACTCGAGTACAGCAAATGGTTGTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-408s1c1
Sequence:CCGGGCCCTTTGATCCTGCATTTATCTCGAGATAAATGCAGGATCAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-171s1c1
Sequence:CCGGGTCAATCACAGGGTGATTCAGCTCGAGCTGAATCACCCTGTGATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-585s1c1
Sequence:CCGGCCACCTGTTCCTGGTCTATTTCTCGAGAAATAGACCAGGAACAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-431s1c1
Sequence:CCGGCCTGTATCTAGATCTTCATTACTCGAGTAATGAAGATCTAGATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153390.1-185s1c1
Sequence:CCGGGATTCAGGAGCATCTTGCACACTCGAGTGTGCAAGATGCTCCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153390.1-447s1c1
Sequence:CCGGCATTAAGAACCAACTTCATTACTCGAGTAATGAAGTTGGTTCTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)