EMAIL THIS PAGE TO A FRIEND

PYCR1

pyrroline-5-carboxylate reductase 1

74 Gene Product Result for
Synonyms: ARCL2B ARCL3B P5C P5CR PIG45 PP222 PRO3 PYCR
UniProtKB ID: P32322, A6NFM2, Q6FHI4, Q96DI6, Q9HBQ4
Gene ID:
Human(5831) Summary: This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(209027) pyrroline-5-carboxylate reductase 1
Rat(287877) pyrroline-5-carboxylate reductase 1
domestic guinea pig(100735068) pyrroline-5-carboxylate reductase 1
naked mole-rat(101719799) pyrroline-5-carboxylate reductase 1
cow(539606) pyrroline-5-carboxylate reductase 1
sheep(101113161) pyrroline-5-carboxylate reductase 1
Zebrafish(393799) pyrroline-5-carboxylate reductase 1
dog(483372) pyrroline-5-carboxylate reductase 1
domestic cat(101090664) pyrroline-5-carboxylate reductase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006907 Rosetta Predictions human pricing
NM_153824 Rosetta Predictions human pricing
NM_001105857 Rosetta Predictions rat pricing
NM_144795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166305 predicted 848
2 SASI_Hs01_00166306 predicted 390
3 SASI_Hs01_00166307 predicted 618
4 SASI_Hs01_00166308 predicted 339
5 SASI_Hs01_00166309 predicted 344
6 SASI_Hs01_00166310 predicted 523
7 SASI_Hs02_00342585 predicted 467
8 SASI_Hs01_00166311 predicted 469
9 SASI_Hs01_00166312 predicted 342
10 SASI_Hs01_00166313 predicted 529
11 SASI_Hs01_00166304 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109373 predicted 850
2 SASI_Hs01_00109375 predicted 392
3 SASI_Hs01_00109376 predicted 626
4 SASI_Hs01_00109377 predicted 336
5 SASI_Hs01_00109378 predicted 345
6 SASI_Hs01_00109379 predicted 520
7 SASI_Hs02_00367504 predicted 469
8 SASI_Hs01_00109380 predicted 467
9 SASI_Hs01_00109381 predicted 346
10 SASI_Hs02_00367505 predicted 525
11 SASI_Hs01_00109372 predicted 1366
12 SASI_Hs01_00109374 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213212 predicted 845
2 SASI_Rn02_00213213 predicted 579
3 SASI_Rn02_00213214 predicted 213
4 SASI_Rn02_00213215 predicted 736
5 SASI_Rn02_00213216 predicted 449
6 SASI_Rn02_00213217 predicted 870
7 SASI_Rn02_00213218 predicted 663
8 SASI_Rn02_00213219 predicted 1471
9 SASI_Rn02_00213220 predicted 426
10 SASI_Rn02_00213221 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340134 predicted 506
2 SASI_Mm02_00340135 predicted 1683
3 SASI_Mm01_00120451 predicted 868
4 SASI_Mm01_00120452 predicted 1185
5 SASI_Mm01_00120453 predicted 617
6 SASI_Mm02_00340136 predicted 469
7 SASI_Mm01_00120457 predicted 687
8 SASI_Mm02_00340137 predicted 1674
9 SASI_Mm01_00120458 predicted 1079
10 SASI_Mm01_00120459 predicted 792
11 SASI_Mm01_00120450 predicted 1520
12 SASI_Mm01_00120454 predicted 1350
13 SASI_Mm01_00120455 predicted 1391
14 SASI_Mm01_00120456 predicted 1429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144795
VALIDATED
PYCR1 MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-700s21c1
Sequence:CCGGCATTGAGGACAGGCACATTGTCTCGAGACAATGTGCCTGTCCTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1449s21c1
Sequence:CCGGGACACCAGCTTCAGGATTAACCTCGAGGTTAATCCTGAAGCTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-517s21c1
Sequence:CCGGTCTGGCTGCACACAAGATAATCTCGAGATTATCTTGTGTGCAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1190s21c1
Sequence:CCGGGGCTTTCGCTCCTTGCTTATCCTCGAGGATAAGCAAGGAGCGAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1085s21c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-788s21c1
Sequence:CCGGCCCAAAGTCATCCGATGTATGCTCGAGCATACATCGGATGACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-740s21c3
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144795.3-1676s21c1
Sequence:CCGGGTAAAGATGACTCACAAATTACTCGAGTAATTTGTGAGTCATCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-1401s1c1
Sequence:CCGGGCTCTCAAACAACACCGAATACTCGAGTATTCGGTGTTGTTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-928s1c1
Sequence:CCGGGCTGCCATAAAGAAGACTGTACTCGAGTACAGTCTTCTTTATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-730s1c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-485s1c1
Sequence:CCGGTCACTGTGTATGCCACAGGTACTCGAGTACCTGTGGCATACACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144795.1-385s1c1
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144795
VALIDATED
PYCR1 MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-700s21c1
Sequence:CCGGCATTGAGGACAGGCACATTGTCTCGAGACAATGTGCCTGTCCTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1449s21c1
Sequence:CCGGGACACCAGCTTCAGGATTAACCTCGAGGTTAATCCTGAAGCTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-517s21c1
Sequence:CCGGTCTGGCTGCACACAAGATAATCTCGAGATTATCTTGTGTGCAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1190s21c1
Sequence:CCGGGGCTTTCGCTCCTTGCTTATCCTCGAGGATAAGCAAGGAGCGAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1085s21c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-788s21c1
Sequence:CCGGCCCAAAGTCATCCGATGTATGCTCGAGCATACATCGGATGACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-740s21c3
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144795.3-1676s21c1
Sequence:CCGGGTAAAGATGACTCACAAATTACTCGAGTAATTTGTGAGTCATCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-1401s1c1
Sequence:CCGGGCTCTCAAACAACACCGAATACTCGAGTATTCGGTGTTGTTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-928s1c1
Sequence:CCGGGCTGCCATAAAGAAGACTGTACTCGAGTACAGTCTTCTTTATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-730s1c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-485s1c1
Sequence:CCGGTCACTGTGTATGCCACAGGTACTCGAGTACCTGTGGCATACACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144795.1-385s1c1
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144795
VALIDATED
PYCR1 MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-700s21c1
Sequence:CCGGCATTGAGGACAGGCACATTGTCTCGAGACAATGTGCCTGTCCTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1449s21c1
Sequence:CCGGGACACCAGCTTCAGGATTAACCTCGAGGTTAATCCTGAAGCTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-517s21c1
Sequence:CCGGTCTGGCTGCACACAAGATAATCTCGAGATTATCTTGTGTGCAGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1190s21c1
Sequence:CCGGGGCTTTCGCTCCTTGCTTATCCTCGAGGATAAGCAAGGAGCGAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-1085s21c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-788s21c1
Sequence:CCGGCCCAAAGTCATCCGATGTATGCTCGAGCATACATCGGATGACTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144795.3-740s21c3
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144795.3-1676s21c1
Sequence:CCGGGTAAAGATGACTCACAAATTACTCGAGTAATTTGTGAGTCATCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-1401s1c1
Sequence:CCGGGCTCTCAAACAACACCGAATACTCGAGTATTCGGTGTTGTTTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-928s1c1
Sequence:CCGGGCTGCCATAAAGAAGACTGTACTCGAGTACAGTCTTCTTTATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144795.1-730s1c1
Sequence:CCGGGCCAAGATGCTACTAGACTCACTCGAGTGAGTCTAGTAGCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144795.1-485s1c1
Sequence:CCGGTCACTGTGTATGCCACAGGTACTCGAGTACCTGTGGCATACACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144795.1-385s1c1
Sequence:CCGGGTCACCATCAACTCCATCGAACTCGAGTTCGATGGAGTTGATGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153824
VALIDATED
PYCR1 MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-504s1c1
Sequence:CCGGCCCTTCATCCTGGATGAAATACTCGAGTATTTCATCCAGGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1034s1c1
Sequence:CCGGCCTGCTCATCAACGCTGTGGACTCGAGTCCACAGCGTTGATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-590s1c1
Sequence:CCGGTGAGAAGAAGCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1176s1c1
Sequence:CCGGGAGGGTCTTCACCCACTCCTACTCGAGTAGGAGTGGGTGAAGACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-398s1c1
Sequence:CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153824
VALIDATED
PYCR1 MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-504s1c1
Sequence:CCGGCCCTTCATCCTGGATGAAATACTCGAGTATTTCATCCAGGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1034s1c1
Sequence:CCGGCCTGCTCATCAACGCTGTGGACTCGAGTCCACAGCGTTGATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-590s1c1
Sequence:CCGGTGAGAAGAAGCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1176s1c1
Sequence:CCGGGAGGGTCTTCACCCACTCCTACTCGAGTAGGAGTGGGTGAAGACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-398s1c1
Sequence:CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153824
VALIDATED
PYCR1 MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-504s1c1
Sequence:CCGGCCCTTCATCCTGGATGAAATACTCGAGTATTTCATCCAGGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1034s1c1
Sequence:CCGGCCTGCTCATCAACGCTGTGGACTCGAGTCCACAGCGTTGATGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-590s1c1
Sequence:CCGGTGAGAAGAAGCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-1176s1c1
Sequence:CCGGGAGGGTCTTCACCCACTCCTACTCGAGTAGGAGTGGGTGAAGACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_153824.1-398s1c1
Sequence:CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)