EMAIL THIS PAGE TO A FRIEND

PYCR2

pyrroline-5-carboxylate reductase family, member 2

47 Gene Product Result for
Synonyms: P5CR2
UniProtKB ID: Q96C36, A8K798, Q7Z515, Q9Y5J4
Gene ID:
Human(29920) Summary: This gene belongs to the pyrroline-5-carboxylate reductase family. The encoded mitochondrial protein catalyzes the conversion of pyrroline-5-carboxylate to proline, which is the last step in proline biosynthesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Mouse(69051) pyrroline-5-carboxylate reductase family, member 2
Rat(364064) pyrroline-5-carboxylate reductase family, member 2
chicken(769203) pyrroline-5-carboxylate reductase family, member 2
domestic cat(101086280) pyrroline-5-carboxylate reductase family, member 2
dog(480112) pyrroline-5-carboxylate reductase family, member 2
cow(504987) pyrroline-5-carboxylate reductase family, member 2
sheep(101111821) pyrroline-5-carboxylate reductase family, member 2
naked mole-rat(101696828) pyrroline-5-carboxylate reductase family, member 2
domestic guinea pig(100712695) pyrroline-5-carboxylate reductase family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013328 Rosetta Predictions human pricing
NM_001012208 Rosetta Predictions rat pricing
NM_133705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013381 predicted 498
2 SASI_Hs01_00013382 predicted 863
3 SASI_Hs01_00013383 predicted 809
4 SASI_Hs01_00013384 predicted 210
5 SASI_Hs01_00013385 predicted 922
6 SASI_Hs01_00013386 predicted 903
7 SASI_Hs01_00013387 predicted 205
8 SASI_Hs01_00013388 predicted 316
9 SASI_Hs01_00013389 predicted 932
10 SASI_Hs01_00013390 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074676 predicted 879
2 SASI_Rn01_00074678 predicted 463
3 SASI_Rn02_00200452 predicted 1214
4 SASI_Rn01_00074680 predicted 413
5 SASI_Rn01_00074681 predicted 257
6 SASI_Rn01_00074682 predicted 740
7 SASI_Rn01_00074683 predicted 1016
8 SASI_Rn01_00074684 predicted 1288
9 SASI_Rn01_00074685 predicted 602
10 SASI_Rn02_00200453 predicted 858
11 SASI_Rn01_00074677 predicted 893
12 SASI_Rn01_00074679 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052204 predicted 307
2 SASI_Mm01_00052205 predicted 876
3 SASI_Mm01_00052207 predicted 590
4 SASI_Mm01_00052208 predicted 234
5 SASI_Mm02_00338674 predicted 936
6 SASI_Mm01_00052209 predicted 1294
7 SASI_Mm01_00052210 predicted 1074
8 SASI_Mm01_00052211 predicted 585
9 SASI_Mm01_00052212 predicted 647
10 SASI_Mm01_00052213 predicted 823
11 SASI_Mm01_00052206 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013328
VALIDATED
PYCR2 MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-996s1c1
Sequence:CCGGGCCCTTAAGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCTTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-228s1c1
Sequence:CCGGCTGTCGGCTCACAAGATAATACTCGAGTATTATCTTGTGAGCCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013328.2-347s1c1
Sequence:CCGGCGTCCTGTTTCTGGCTGTGAACTCGAGTTCACAGCCAGAAACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1518s21c1
Sequence:CCGGGCTTTCTCTGAATTGGTAAATCTCGAGATTTACCAATTCAGAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-825s1c1
Sequence:CCGGCCATGCCAGCTTAAGGACAATCTCGAGATTGTCCTTAAGCTGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-1007s1c1
Sequence:CCGGGACCCTCTTAGACAGAGTGAACTCGAGTTCACTCTGTCTAAGAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-699s21c1
Sequence:CCGGTTCATGGCTCTGGACGCATTGCTCGAGCAATGCGTCCAGAGCCATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1221s21c1
Sequence:CCGGGCAAGGAGAAAGCATGCTTAGCTCGAGCTAAGCATGCTTTCTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-961s21c1
Sequence:CCGGAGTCCATGGCCGACCAAGAAACTCGAGTTTCTTGGTCGGCCATGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013328
VALIDATED
PYCR2 MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-996s1c1
Sequence:CCGGGCCCTTAAGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCTTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-228s1c1
Sequence:CCGGCTGTCGGCTCACAAGATAATACTCGAGTATTATCTTGTGAGCCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013328.2-347s1c1
Sequence:CCGGCGTCCTGTTTCTGGCTGTGAACTCGAGTTCACAGCCAGAAACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1518s21c1
Sequence:CCGGGCTTTCTCTGAATTGGTAAATCTCGAGATTTACCAATTCAGAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-825s1c1
Sequence:CCGGCCATGCCAGCTTAAGGACAATCTCGAGATTGTCCTTAAGCTGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-1007s1c1
Sequence:CCGGGACCCTCTTAGACAGAGTGAACTCGAGTTCACTCTGTCTAAGAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-699s21c1
Sequence:CCGGTTCATGGCTCTGGACGCATTGCTCGAGCAATGCGTCCAGAGCCATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1221s21c1
Sequence:CCGGGCAAGGAGAAAGCATGCTTAGCTCGAGCTAAGCATGCTTTCTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-961s21c1
Sequence:CCGGAGTCCATGGCCGACCAAGAAACTCGAGTTTCTTGGTCGGCCATGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013328
VALIDATED
PYCR2 MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-996s1c1
Sequence:CCGGGCCCTTAAGAAGACCCTCTTACTCGAGTAAGAGGGTCTTCTTAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-228s1c1
Sequence:CCGGCTGTCGGCTCACAAGATAATACTCGAGTATTATCTTGTGAGCCGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013328.2-347s1c1
Sequence:CCGGCGTCCTGTTTCTGGCTGTGAACTCGAGTTCACAGCCAGAAACAGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1518s21c1
Sequence:CCGGGCTTTCTCTGAATTGGTAAATCTCGAGATTTACCAATTCAGAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-825s1c1
Sequence:CCGGCCATGCCAGCTTAAGGACAATCTCGAGATTGTCCTTAAGCTGGCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013328.2-1007s1c1
Sequence:CCGGGACCCTCTTAGACAGAGTGAACTCGAGTTCACTCTGTCTAAGAGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-699s21c1
Sequence:CCGGTTCATGGCTCTGGACGCATTGCTCGAGCAATGCGTCCAGAGCCATGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013328.2-1221s21c1
Sequence:CCGGGCAAGGAGAAAGCATGCTTAGCTCGAGCTAAGCATGCTTTCTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013328.2-961s21c1
Sequence:CCGGAGTCCATGGCCGACCAAGAAACTCGAGTTTCTTGGTCGGCCATGGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133705
PYCR2 MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase family, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-650s1c1
Sequence:CCGGGTGGAGGAAGACCTCATTGATCTCGAGATCAATGAGGTCTTCCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-325s1c1
Sequence:CCGGCCGAAGCAATAAGGACACTGTCTCGAGACAGTGTCCTTATTGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133705.1-1407s1c1
Sequence:CCGGGAAACGGGAATCCTCTGAATTCTCGAGAATTCAGAGGATTCCCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-1020s21c1
Sequence:CCGGTGTCTCCTGCTGCCCTTAAGACTCGAGTCTTAAGGGCAGCAGGAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-1077s1c1
Sequence:CCGGGCTCAGGGAAACTCCTTACAACTCGAGTTGTAAGGAGTTTCCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-996s21c1
Sequence:CCGGAGTCCATGGCTGACCAAGAAACTCGAGTTTCTTGGTCAGCCATGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-463s1c1
Sequence:CCGGCACCATCAGTTCTGTGGAGAACTCGAGTTCTCCACAGAACTGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-817s21c1
Sequence:CCGGGTTGCTGGGAGCAGCTAAGATCTCGAGATCTTAGCTGCTCCCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133705.2-1368s21c1
Sequence:CCGGGTCTGTGGAGAGCTTTAGTTACTCGAGTAACTAAAGCTCTCCACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133705
PYCR2 MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase family, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-650s1c1
Sequence:CCGGGTGGAGGAAGACCTCATTGATCTCGAGATCAATGAGGTCTTCCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-325s1c1
Sequence:CCGGCCGAAGCAATAAGGACACTGTCTCGAGACAGTGTCCTTATTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133705.1-1407s1c1
Sequence:CCGGGAAACGGGAATCCTCTGAATTCTCGAGAATTCAGAGGATTCCCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-1020s21c1
Sequence:CCGGTGTCTCCTGCTGCCCTTAAGACTCGAGTCTTAAGGGCAGCAGGAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-1077s1c1
Sequence:CCGGGCTCAGGGAAACTCCTTACAACTCGAGTTGTAAGGAGTTTCCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-996s21c1
Sequence:CCGGAGTCCATGGCTGACCAAGAAACTCGAGTTTCTTGGTCAGCCATGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-463s1c1
Sequence:CCGGCACCATCAGTTCTGTGGAGAACTCGAGTTCTCCACAGAACTGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-817s21c1
Sequence:CCGGGTTGCTGGGAGCAGCTAAGATCTCGAGATCTTAGCTGCTCCCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133705.2-1368s21c1
Sequence:CCGGGTCTGTGGAGAGCTTTAGTTACTCGAGTAACTAAAGCTCTCCACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133705
PYCR2 MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase family, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-650s1c1
Sequence:CCGGGTGGAGGAAGACCTCATTGATCTCGAGATCAATGAGGTCTTCCTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-325s1c1
Sequence:CCGGCCGAAGCAATAAGGACACTGTCTCGAGACAGTGTCCTTATTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133705.1-1407s1c1
Sequence:CCGGGAAACGGGAATCCTCTGAATTCTCGAGAATTCAGAGGATTCCCGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-1020s21c1
Sequence:CCGGTGTCTCCTGCTGCCCTTAAGACTCGAGTCTTAAGGGCAGCAGGAGACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-1077s1c1
Sequence:CCGGGCTCAGGGAAACTCCTTACAACTCGAGTTGTAAGGAGTTTCCCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-996s21c1
Sequence:CCGGAGTCCATGGCTGACCAAGAAACTCGAGTTTCTTGGTCAGCCATGGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133705.1-463s1c1
Sequence:CCGGCACCATCAGTTCTGTGGAGAACTCGAGTTCTCCACAGAACTGATGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133705.2-817s21c1
Sequence:CCGGGTTGCTGGGAGCAGCTAAGATCTCGAGATCTTAGCTGCTCCCAGCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133705.2-1368s21c1
Sequence:CCGGGTCTGTGGAGAGCTTTAGTTACTCGAGTAACTAAAGCTCTCCACAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)