EMAIL THIS PAGE TO A FRIEND

PYCRL

pyrroline-5-carboxylate reductase-like

68 Gene Product Result for
UniProtKB ID: Q53H96, B3KMB5, Q8N3N9, Q96HX4, Q9H896
Gene ID:
Mouse(66194) pyrroline-5-carboxylate reductase-like
Rat(300035) pyrroline-5-carboxylate reductase-like
domestic guinea pig(100732634) pyrroline-5-carboxylate reductase-like
naked mole-rat(101719535) pyrroline-5-carboxylate reductase-like
cow(512526) pyrroline-5-carboxylate reductase-like
sheep(101117514) pyrroline-5-carboxylate reductase-like
Zebrafish(560682) pyrroline-5-carboxylate reductase-like
chicken(420293) pyrroline-5-carboxylate reductase-like
domestic cat(101090490) pyrroline-5-carboxylate reductase-like
dog(482079) pyrroline-5-carboxylate reductase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156151 MISSION® esiRNA esiRNA human PYCRL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023078 Rosetta Predictions human pricing
NM_001011993 Rosetta Predictions rat pricing
XM_576295 Rosetta Predictions rat pricing
NM_025412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108164 predicted 1138
2 SASI_Hs01_00108165 predicted 605
3 SASI_Hs02_00356324 predicted 462
4 SASI_Hs01_00108167 predicted 254
5 SASI_Hs01_00108168 predicted 928
6 SASI_Hs01_00108169 predicted 296
7 SASI_Hs01_00108170 predicted 1131
8 SASI_Hs02_00356325 predicted 1243
9 SASI_Hs01_00108171 predicted 206
10 SASI_Hs02_00356326 predicted 287
11 SASI_Hs01_00108163 predicted 288
12 SASI_Hs01_00108166 predicted 825
13 SASI_Hs01_00108172 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200027 predicted 843
2 SASI_Rn02_00200028 predicted 792
3 SASI_Rn02_00200029 predicted 842
4 SASI_Rn02_00200030 predicted 554
5 SASI_Rn02_00200031 predicted 862
6 SASI_Rn02_00200032 predicted 412
7 SASI_Rn02_00200033 predicted 845
8 SASI_Rn02_00200034 predicted 802
9 SASI_Rn02_00200035 predicted 602
10 SASI_Rn02_00200036 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148577 predicted 602
2 SASI_Rn01_00148578 predicted 847
3 SASI_Rn01_00148579 predicted 1381
4 SASI_Rn01_00148580 predicted 846
5 SASI_Rn01_00148581 predicted 1010
6 SASI_Rn01_00148582 predicted 1219
7 SASI_Rn01_00148583 predicted 1217
8 SASI_Rn01_00148584 predicted 556
9 SASI_Rn01_00148585 predicted 111
10 SASI_Rn01_00148586 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121629 predicted 1003
2 SASI_Mm01_00121628 predicted 217
3 SASI_Mm02_00328182 predicted 509
4 SASI_Mm02_00328183 predicted 369
5 SASI_Mm01_00121632 predicted 999
6 SASI_Mm02_00328184 predicted 400
7 SASI_Mm02_00328185 predicted 1081
8 SASI_Mm02_00328186 predicted 1132
9 SASI_Mm02_00328187 predicted 1030
10 SASI_Mm02_00328188 predicted 300
11 SASI_Mm01_00121630 predicted 1041
12 SASI_Mm01_00121631 predicted 1005
13 SASI_Mm01_00121633 predicted 785
14 SASI_Mm01_00121634 predicted 886
15 SASI_Mm01_00121635 predicted 452
16 SASI_Mm01_00121636 predicted 537
17 SASI_Mm01_00121637 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025412
VALIDATED
PYCRL MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase-like
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-373s21c1
Sequence:CCGGCACTGAGCACATCATCGTATCCTCGAGGATACGATGATGTGCTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1037s21c1
Sequence:CCGGGAAGCGGTGACTACTTGTAAGCTCGAGCTTACAAGTAGTCACCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-297s21c1
Sequence:CCGGACTGCCCACTTGTCATCTTTGCTCGAGCAAAGATGACAAGTGGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1010s21c1
Sequence:CCGGTCTAAGTGGAATGGCTAATTTCTCGAGAAATTAGCCATTCCACTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-183s21c1
Sequence:CCGGCAGGCAAAGTAGAAGCTAAACCTCGAGGTTTAGCTTCTACTTTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-215s21c1
Sequence:CCGGAGTGCACCAACGGACAACAACCTCGAGGTTGTTGTCCGTTGGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-635s21c1
Sequence:CCGGGTGGCCTTTGTGTGTACATTTCTCGAGAAATGTACACACAAAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-668s1c1
Sequence:CCGGCCTGGCTGAAGGTGCCATCAACTCGAGTTGATGGCACCTTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-589s21c1
Sequence:CCGGTCCCGAGTCCTACGTAGATATCTCGAGATATCTACGTAGGACTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-186s1c1
Sequence:CCGGGCAGGCAAAGTAGAAGCTAAACTCGAGTTTAGCTTCTACTTTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-267s1c1
Sequence:CCGGCAGACTAATCACTCCAACCATCTCGAGATGGTTGGAGTGATTAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-368s1c1
Sequence:CCGGCATAATCAACACTGAGCACATCTCGAGATGTGCTCAGTGTTGATTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025412.1-542s1c1
Sequence:CCGGCGCAGAGCTCATACAGAACTTCTCGAGAAGTTCTGTATGAGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025412
VALIDATED
PYCRL MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase-like
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-373s21c1
Sequence:CCGGCACTGAGCACATCATCGTATCCTCGAGGATACGATGATGTGCTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1037s21c1
Sequence:CCGGGAAGCGGTGACTACTTGTAAGCTCGAGCTTACAAGTAGTCACCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-297s21c1
Sequence:CCGGACTGCCCACTTGTCATCTTTGCTCGAGCAAAGATGACAAGTGGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1010s21c1
Sequence:CCGGTCTAAGTGGAATGGCTAATTTCTCGAGAAATTAGCCATTCCACTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-183s21c1
Sequence:CCGGCAGGCAAAGTAGAAGCTAAACCTCGAGGTTTAGCTTCTACTTTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-215s21c1
Sequence:CCGGAGTGCACCAACGGACAACAACCTCGAGGTTGTTGTCCGTTGGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-635s21c1
Sequence:CCGGGTGGCCTTTGTGTGTACATTTCTCGAGAAATGTACACACAAAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-668s1c1
Sequence:CCGGCCTGGCTGAAGGTGCCATCAACTCGAGTTGATGGCACCTTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-589s21c1
Sequence:CCGGTCCCGAGTCCTACGTAGATATCTCGAGATATCTACGTAGGACTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-186s1c1
Sequence:CCGGGCAGGCAAAGTAGAAGCTAAACTCGAGTTTAGCTTCTACTTTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-267s1c1
Sequence:CCGGCAGACTAATCACTCCAACCATCTCGAGATGGTTGGAGTGATTAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-368s1c1
Sequence:CCGGCATAATCAACACTGAGCACATCTCGAGATGTGCTCAGTGTTGATTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025412.1-542s1c1
Sequence:CCGGCGCAGAGCTCATACAGAACTTCTCGAGAAGTTCTGTATGAGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025412
VALIDATED
PYCRL MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase-like
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-373s21c1
Sequence:CCGGCACTGAGCACATCATCGTATCCTCGAGGATACGATGATGTGCTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1037s21c1
Sequence:CCGGGAAGCGGTGACTACTTGTAAGCTCGAGCTTACAAGTAGTCACCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-297s21c1
Sequence:CCGGACTGCCCACTTGTCATCTTTGCTCGAGCAAAGATGACAAGTGGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-1010s21c1
Sequence:CCGGTCTAAGTGGAATGGCTAATTTCTCGAGAAATTAGCCATTCCACTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-183s21c1
Sequence:CCGGCAGGCAAAGTAGAAGCTAAACCTCGAGGTTTAGCTTCTACTTTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-215s21c1
Sequence:CCGGAGTGCACCAACGGACAACAACCTCGAGGTTGTTGTCCGTTGGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-635s21c1
Sequence:CCGGGTGGCCTTTGTGTGTACATTTCTCGAGAAATGTACACACAAAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-668s1c1
Sequence:CCGGCCTGGCTGAAGGTGCCATCAACTCGAGTTGATGGCACCTTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025412.2-589s21c1
Sequence:CCGGTCCCGAGTCCTACGTAGATATCTCGAGATATCTACGTAGGACTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-186s1c1
Sequence:CCGGGCAGGCAAAGTAGAAGCTAAACTCGAGTTTAGCTTCTACTTTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-267s1c1
Sequence:CCGGCAGACTAATCACTCCAACCATCTCGAGATGGTTGGAGTGATTAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025412.1-368s1c1
Sequence:CCGGCATAATCAACACTGAGCACATCTCGAGATGTGCTCAGTGTTGATTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025412.1-542s1c1
Sequence:CCGGCGCAGAGCTCATACAGAACTTCTCGAGAAGTTCTGTATGAGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023078
VALIDATED
PYCRL MISSION shRNA Bacterial Glycerol Stock
pyrroline-5-carboxylate reductase-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-2153s1c1
Sequence:CCGGATCTGCTCTCTCTTACTCTCCCTCGAGGGAGAGTAAGAGAGAGCAGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1183s1c1
Sequence:CCGGTGAGGCCATGAACAGAACTTACTCGAGTAAGTTCTGTTCATGGCCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2156s1c1
Sequence:CCGGTGCTCTCTCTTACTCTCCTGACTCGAGTCAGGAGAGTAAGAGAGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2280s1c1
Sequence:CCGGCTAAGGAGATGGGAATAAAGACTCGAGTCTTTATTCCCATCTCCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1190s1c1
Sequence:CCGGATGAACAGAACTTACGGTAACCTCGAGGTTACCGTAAGTTCTGTTCATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1629s1c1
Sequence:CCGGATCCTAAGCTCCTGACAAGTGCTCGAGCACTTGTCAGGAGCTTAGGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1185s1c1
Sequence:CCGGAGGCCATGAACAGAACTTACGCTCGAGCGTAAGTTCTGTTCATGGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1187s1c1
Sequence:CCGGGCCATGAACAGAACTTACGGTCTCGAGACCGTAAGTTCTGTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-151s1c1
Sequence:CCGGCACCAACAGACAGGAACCTATCTCGAGATAGGTTCCTGTCTGTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1189s1c1
Sequence:CCGGCATGAACAGAACTTACGGTAACTCGAGTTACCGTAAGTTCTGTTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1188s1c1
Sequence:CCGGCCATGAACAGAACTTACGGTACTCGAGTACCGTAAGTTCTGTTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2281s1c1
Sequence:CCGGTAAGGAGATGGGAATAAAGAGCTCGAGCTCTTTATTCCCATCTCCTTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1184s1c1
Sequence:CCGGGAGGCCATGAACAGAACTTACCTCGAGGTAAGTTCTGTTCATGGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023078
VALIDATED
PYCRL MISSION shRNA shRNA Plasmid DNA
pyrroline-5-carboxylate reductase-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-2153s1c1
Sequence:CCGGATCTGCTCTCTCTTACTCTCCCTCGAGGGAGAGTAAGAGAGAGCAGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1183s1c1
Sequence:CCGGTGAGGCCATGAACAGAACTTACTCGAGTAAGTTCTGTTCATGGCCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2156s1c1
Sequence:CCGGTGCTCTCTCTTACTCTCCTGACTCGAGTCAGGAGAGTAAGAGAGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2280s1c1
Sequence:CCGGCTAAGGAGATGGGAATAAAGACTCGAGTCTTTATTCCCATCTCCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1190s1c1
Sequence:CCGGATGAACAGAACTTACGGTAACCTCGAGGTTACCGTAAGTTCTGTTCATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1629s1c1
Sequence:CCGGATCCTAAGCTCCTGACAAGTGCTCGAGCACTTGTCAGGAGCTTAGGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1185s1c1
Sequence:CCGGAGGCCATGAACAGAACTTACGCTCGAGCGTAAGTTCTGTTCATGGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1187s1c1
Sequence:CCGGGCCATGAACAGAACTTACGGTCTCGAGACCGTAAGTTCTGTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-151s1c1
Sequence:CCGGCACCAACAGACAGGAACCTATCTCGAGATAGGTTCCTGTCTGTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1189s1c1
Sequence:CCGGCATGAACAGAACTTACGGTAACTCGAGTTACCGTAAGTTCTGTTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1188s1c1
Sequence:CCGGCCATGAACAGAACTTACGGTACTCGAGTACCGTAAGTTCTGTTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2281s1c1
Sequence:CCGGTAAGGAGATGGGAATAAAGAGCTCGAGCTCTTTATTCCCATCTCCTTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1184s1c1
Sequence:CCGGGAGGCCATGAACAGAACTTACCTCGAGGTAAGTTCTGTTCATGGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023078
VALIDATED
PYCRL MISSION shRNA Lentiviral Transduction Particles
pyrroline-5-carboxylate reductase-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-2153s1c1
Sequence:CCGGATCTGCTCTCTCTTACTCTCCCTCGAGGGAGAGTAAGAGAGAGCAGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1183s1c1
Sequence:CCGGTGAGGCCATGAACAGAACTTACTCGAGTAAGTTCTGTTCATGGCCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2156s1c1
Sequence:CCGGTGCTCTCTCTTACTCTCCTGACTCGAGTCAGGAGAGTAAGAGAGAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2280s1c1
Sequence:CCGGCTAAGGAGATGGGAATAAAGACTCGAGTCTTTATTCCCATCTCCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1190s1c1
Sequence:CCGGATGAACAGAACTTACGGTAACCTCGAGGTTACCGTAAGTTCTGTTCATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1629s1c1
Sequence:CCGGATCCTAAGCTCCTGACAAGTGCTCGAGCACTTGTCAGGAGCTTAGGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1185s1c1
Sequence:CCGGAGGCCATGAACAGAACTTACGCTCGAGCGTAAGTTCTGTTCATGGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1187s1c1
Sequence:CCGGGCCATGAACAGAACTTACGGTCTCGAGACCGTAAGTTCTGTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-151s1c1
Sequence:CCGGCACCAACAGACAGGAACCTATCTCGAGATAGGTTCCTGTCTGTTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-1189s1c1
Sequence:CCGGCATGAACAGAACTTACGGTAACTCGAGTTACCGTAAGTTCTGTTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1188s1c1
Sequence:CCGGCCATGAACAGAACTTACGGTACTCGAGTACCGTAAGTTCTGTTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023078.x-2281s1c1
Sequence:CCGGTAAGGAGATGGGAATAAAGAGCTCGAGCTCTTTATTCCCATCTCCTTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023078.x-1184s1c1
Sequence:CCGGGAGGCCATGAACAGAACTTACCTCGAGGTAAGTTCTGTTCATGGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)