EMAIL THIS PAGE TO A FRIEND

PYDC1

PYD (pyrin domain) containing 1

15 Gene Product Result for
Synonyms: ASC2 POP1 PYC1
Species: Human PYDC1(260434)
UniProtKB ID: Q8WXC3, B2R8L4, Q8NFP8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302029 ANTI-PYDC1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152901 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139511 MISSION® esiRNA esiRNA human PYDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152901 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034219 predicted 203
2 SASI_Hs01_00034220 predicted 296
3 SASI_Hs01_00034221 predicted 268
4 SASI_Hs01_00034222 predicted 296
5 SASI_Hs01_00034223 predicted 209
6 SASI_Hs01_00034224 predicted 303
7 SASI_Hs01_00034225 predicted 219
8 SASI_Hs01_00034226 predicted 217
9 SASI_Hs01_00034227 predicted 258
10 SASI_Hs01_00034228 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152901
PYDC1 MISSION shRNA Bacterial Glycerol Stock
PYD (pyrin domain) containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-270s1c1
Sequence:CCGGGCTGCGCGACATGCGCATGTTCTCGAGAACATGCGCATGTCGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-193s21c1
Sequence:CCGGTATCGTGGACCTCACCGACAACTCGAGTTGTCGGTGAGGTCCACGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-111s1c1
Sequence:CCGGGCTCAAGAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-189s1c1
Sequence:CCGGGCAGCTAGATATCGTGGACCTCTCGAGAGGTCCACGATATCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-150s1c1
Sequence:CCGGGCGCGAGGGCTTTGAGCGCATCTCGAGATGCGCTCAAAGCCCTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-210s21c1
Sequence:CCGGACAAGCTGGTCGCCTCCTACTCTCGAGAGTAGGAGGCGACCAGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-224s21c1
Sequence:CCGGTCCTACTACGAGGACTACGCACTCGAGTGCGTAGTCCTCGTAGTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-75s21c1
Sequence:CCGGTGAAGGTGCTGGAGAACCTGACTCGAGTCAGGTTCTCCAGCACCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-97s21c1
Sequence:CCGGACCGGAGGAGCTCAAGAAGTTCTCGAGAACTTCTTGAGCTCCTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152901
PYDC1 MISSION shRNA shRNA Plasmid DNA
PYD (pyrin domain) containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-270s1c1
Sequence:CCGGGCTGCGCGACATGCGCATGTTCTCGAGAACATGCGCATGTCGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-193s21c1
Sequence:CCGGTATCGTGGACCTCACCGACAACTCGAGTTGTCGGTGAGGTCCACGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-111s1c1
Sequence:CCGGGCTCAAGAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-189s1c1
Sequence:CCGGGCAGCTAGATATCGTGGACCTCTCGAGAGGTCCACGATATCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-150s1c1
Sequence:CCGGGCGCGAGGGCTTTGAGCGCATCTCGAGATGCGCTCAAAGCCCTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-210s21c1
Sequence:CCGGACAAGCTGGTCGCCTCCTACTCTCGAGAGTAGGAGGCGACCAGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-224s21c1
Sequence:CCGGTCCTACTACGAGGACTACGCACTCGAGTGCGTAGTCCTCGTAGTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-75s21c1
Sequence:CCGGTGAAGGTGCTGGAGAACCTGACTCGAGTCAGGTTCTCCAGCACCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-97s21c1
Sequence:CCGGACCGGAGGAGCTCAAGAAGTTCTCGAGAACTTCTTGAGCTCCTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152901
PYDC1 MISSION shRNA Lentiviral Transduction Particles
PYD (pyrin domain) containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-270s1c1
Sequence:CCGGGCTGCGCGACATGCGCATGTTCTCGAGAACATGCGCATGTCGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-193s21c1
Sequence:CCGGTATCGTGGACCTCACCGACAACTCGAGTTGTCGGTGAGGTCCACGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-111s1c1
Sequence:CCGGGCTCAAGAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-189s1c1
Sequence:CCGGGCAGCTAGATATCGTGGACCTCTCGAGAGGTCCACGATATCTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152901.1-150s1c1
Sequence:CCGGGCGCGAGGGCTTTGAGCGCATCTCGAGATGCGCTCAAAGCCCTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-210s21c1
Sequence:CCGGACAAGCTGGTCGCCTCCTACTCTCGAGAGTAGGAGGCGACCAGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-224s21c1
Sequence:CCGGTCCTACTACGAGGACTACGCACTCGAGTGCGTAGTCCTCGTAGTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-75s21c1
Sequence:CCGGTGAAGGTGCTGGAGAACCTGACTCGAGTCAGGTTCTCCAGCACCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152901.2-97s21c1
Sequence:CCGGACCGGAGGAGCTCAAGAAGTTCTCGAGAACTTCTTGAGCTCCTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)