EMAIL THIS PAGE TO A FRIEND

PYGL

phosphorylase, glycogen, liver

54 Gene Product Result for
Synonyms: GSD6
Gene ID:
Human(5836) Summary: This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Mouse(110095) liver glycogen phosphorylase
Rat(64035) phosphorylase, glycogen, liver
domestic guinea pig(100721433) phosphorylase, glycogen, liver
naked mole-rat(101723998) phosphorylase, glycogen, liver
cow(505472) phosphorylase, glycogen, liver
sheep(554320) phosphorylase, glycogen, liver
Zebrafish(493916) phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI)
chicken(378909) phosphorylase, glycogen, liver
domestic cat(101089364) phosphorylase, glycogen, liver
Horse(100066726) phosphorylase, glycogen, liver
dog(403738) phosphorylase, glycogen, liver
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1542 1,4-Dideoxy-1,4-imino-D-arabinitol hydrochloride enzyme inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037491 MISSION® esiRNA esiRNA human PYGL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002863 Rosetta Predictions human pricing
NM_022268 Rosetta Predictions rat pricing
NM_133198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031948 predicted 439
2 SASI_Hs01_00031950 predicted 2602
3 SASI_Hs01_00031951 predicted 1861
4 SASI_Hs01_00031952 predicted 1911
5 SASI_Hs01_00031953 predicted 2447
6 SASI_Hs01_00031955 predicted 871
7 SASI_Hs01_00031956 predicted 662
8 SASI_Hs01_00031957 predicted 404
9 SASI_Hs02_00334633 predicted 2024
10 SASI_Hs02_00334634 predicted 981
11 SASI_Hs01_00031949 predicted 397
12 SASI_Hs01_00031954 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071278 predicted 2353
2 SASI_Rn01_00071279 predicted 293
3 SASI_Rn02_00263073 predicted 2349
4 SASI_Rn02_00263074 predicted 757
5 SASI_Rn01_00071280 predicted 828
6 SASI_Rn01_00071281 predicted 643
7 SASI_Rn01_00071282 predicted 2238
8 SASI_Rn01_00071283 predicted 304
9 SASI_Rn01_00071286 predicted 2287
10 SASI_Rn01_00071287 predicted 1910
11 SASI_Rn01_00071284 predicted 1760
12 SASI_Rn01_00071285 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045542 predicted 329
2 SASI_Mm01_00045544 predicted 774
3 SASI_Mm02_00338385 predicted 1231
4 SASI_Mm01_00045545 predicted 305
5 SASI_Mm02_00338386 predicted 2368
6 SASI_Mm01_00045546 predicted 1290
7 SASI_Mm01_00045547 predicted 368
8 SASI_Mm02_00338387 predicted 1136
9 SASI_Mm01_00045548 predicted 580
10 SASI_Mm01_00045550 predicted 1771
11 SASI_Mm01_00045543 predicted 2373
12 SASI_Mm01_00045549 predicted 1274
13 SASI_Mm01_00045551 predicted 2310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133198
PYGL MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen, liver
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-500s21c1
Sequence:CCGGTATGGCTACGGCATTCGTTATCTCGAGATAACGAATGCCGTAGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-268s21c1
Sequence:CCGGGTGTCCCAAGAGGGTGTATTACTCGAGTAATACACCCTCTTGGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1535s1c1
Sequence:CCGGGCTGACTTGATAGCAGAGAAACTCGAGTTTCTCTGCTATCAAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1227s21c1
Sequence:CCGGCTCGACACTTGGAGATCATTTCTCGAGAAATGATCTCCAAGTGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133198.1-2609s1c1
Sequence:CCGGCAATGACTTCTTATGGAACTTCTCGAGAAGTTCCATAAGAAGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1463s1c1
Sequence:CCGGCCAGACAAGTTCCAGAATAAACTCGAGTTTATTCTGGAACTTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133198.1-2603s21c1
Sequence:CCGGCTTATTCAATGACTTCTTATGCTCGAGCATAAGAAGTCATTGAATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1421s21c1
Sequence:CCGGATCGTGAAGACCCAAGTATTCCTCGAGGAATACTTGGGTCTTCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133198
PYGL MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen, liver
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-500s21c1
Sequence:CCGGTATGGCTACGGCATTCGTTATCTCGAGATAACGAATGCCGTAGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-268s21c1
Sequence:CCGGGTGTCCCAAGAGGGTGTATTACTCGAGTAATACACCCTCTTGGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1535s1c1
Sequence:CCGGGCTGACTTGATAGCAGAGAAACTCGAGTTTCTCTGCTATCAAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1227s21c1
Sequence:CCGGCTCGACACTTGGAGATCATTTCTCGAGAAATGATCTCCAAGTGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133198.1-2609s1c1
Sequence:CCGGCAATGACTTCTTATGGAACTTCTCGAGAAGTTCCATAAGAAGTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1463s1c1
Sequence:CCGGCCAGACAAGTTCCAGAATAAACTCGAGTTTATTCTGGAACTTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133198.1-2603s21c1
Sequence:CCGGCTTATTCAATGACTTCTTATGCTCGAGCATAAGAAGTCATTGAATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1421s21c1
Sequence:CCGGATCGTGAAGACCCAAGTATTCCTCGAGGAATACTTGGGTCTTCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133198
PYGL MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen, liver
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-500s21c1
Sequence:CCGGTATGGCTACGGCATTCGTTATCTCGAGATAACGAATGCCGTAGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-268s21c1
Sequence:CCGGGTGTCCCAAGAGGGTGTATTACTCGAGTAATACACCCTCTTGGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1535s1c1
Sequence:CCGGGCTGACTTGATAGCAGAGAAACTCGAGTTTCTCTGCTATCAAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1227s21c1
Sequence:CCGGCTCGACACTTGGAGATCATTTCTCGAGAAATGATCTCCAAGTGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133198.1-2609s1c1
Sequence:CCGGCAATGACTTCTTATGGAACTTCTCGAGAAGTTCCATAAGAAGTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133198.1-1463s1c1
Sequence:CCGGCCAGACAAGTTCCAGAATAAACTCGAGTTTATTCTGGAACTTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133198.1-2603s21c1
Sequence:CCGGCTTATTCAATGACTTCTTATGCTCGAGCATAAGAAGTCATTGAATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133198.1-1421s21c1
Sequence:CCGGATCGTGAAGACCCAAGTATTCCTCGAGGAATACTTGGGTCTTCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002863
VALIDATED
PYGL MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen, liver
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002863.2-1028s1c1
Sequence:CCGGGCAAGATATCATCCGCCGTTTCTCGAGAAACGGCGGATGATATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-2452s1c1
Sequence:CCGGCCTATGTCAAGTGTCAAGATACTCGAGTATCTTGACACTTGACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-1305s1c1
Sequence:CCGGCCTCGACATTTGGAAATCATTCTCGAGAATGATTTCCAAATGTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1947s21c1
Sequence:CCGGCCAGGATATCACATGGCCAAACTCGAGTTTGGCCATGTGATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002863.3-2623s21c1
Sequence:CCGGTATCCAATGAATCTAACAAAGCTCGAGCTTTGTTAGATTCATTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-453s21c1
Sequence:CCGGTACCAGCTTGGATTGGATATACTCGAGTATATCCAATCCAAGCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-2451s21c1
Sequence:CCGGGCCTATGTCAAGTGTCAAGATCTCGAGATCTTGACACTTGACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1868s21c1
Sequence:CCGGCACGATGTACAACCGCATTAACTCGAGTTAATGCGGTTGTACATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002863
VALIDATED
PYGL MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen, liver
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002863.2-1028s1c1
Sequence:CCGGGCAAGATATCATCCGCCGTTTCTCGAGAAACGGCGGATGATATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-2452s1c1
Sequence:CCGGCCTATGTCAAGTGTCAAGATACTCGAGTATCTTGACACTTGACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-1305s1c1
Sequence:CCGGCCTCGACATTTGGAAATCATTCTCGAGAATGATTTCCAAATGTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1947s21c1
Sequence:CCGGCCAGGATATCACATGGCCAAACTCGAGTTTGGCCATGTGATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002863.3-2623s21c1
Sequence:CCGGTATCCAATGAATCTAACAAAGCTCGAGCTTTGTTAGATTCATTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-453s21c1
Sequence:CCGGTACCAGCTTGGATTGGATATACTCGAGTATATCCAATCCAAGCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-2451s21c1
Sequence:CCGGGCCTATGTCAAGTGTCAAGATCTCGAGATCTTGACACTTGACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1868s21c1
Sequence:CCGGCACGATGTACAACCGCATTAACTCGAGTTAATGCGGTTGTACATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002863
VALIDATED
PYGL MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen, liver
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002863.2-1028s1c1
Sequence:CCGGGCAAGATATCATCCGCCGTTTCTCGAGAAACGGCGGATGATATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-2452s1c1
Sequence:CCGGCCTATGTCAAGTGTCAAGATACTCGAGTATCTTGACACTTGACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002863.2-1305s1c1
Sequence:CCGGCCTCGACATTTGGAAATCATTCTCGAGAATGATTTCCAAATGTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1947s21c1
Sequence:CCGGCCAGGATATCACATGGCCAAACTCGAGTTTGGCCATGTGATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002863.3-2623s21c1
Sequence:CCGGTATCCAATGAATCTAACAAAGCTCGAGCTTTGTTAGATTCATTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-453s21c1
Sequence:CCGGTACCAGCTTGGATTGGATATACTCGAGTATATCCAATCCAAGCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-2451s21c1
Sequence:CCGGGCCTATGTCAAGTGTCAAGATCTCGAGATCTTGACACTTGACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002863.3-1868s21c1
Sequence:CCGGCACGATGTACAACCGCATTAACTCGAGTTAATGCGGTTGTACATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)