EMAIL THIS PAGE TO A FRIEND

PYGM

phosphorylase, glycogen, muscle

76 Gene Product Result for
UniProtKB ID: P11217, A0AVK1, A6NDY6
Gene ID:
Human(5837) Summary: This gene encodes a muscle enzyme involved in glycogenolysis. Highly similar enzymes encoded by different genes are found in liver and brain. Mutations in this gene are associated with McArdle disease (myophosphorylase deficiency), a glycogen storage disease of muscle. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
Mouse(19309) muscle glycogen phosphorylase
Rat(24701) phosphorylase, glycogen, muscle
dog(611078) phosphorylase, glycogen, muscle
Horse(100050345) phosphorylase, glycogen, muscle
domestic cat(101100836) phosphorylase, glycogen, muscle
cow(327664) phosphorylase, glycogen, muscle
sheep(442998) phosphorylase, glycogen, muscle
naked mole-rat(101713354) phosphorylase, glycogen, muscle
Domestic Rabbit(100008972) phosphorylase, glycogen, muscle
domestic guinea pig(100722429) phosphorylase, glycogen, muscle
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
158968 α-D-Glucose anhydrous, 96% human pricing
G7528 D-(+)-Glucose BioXtra, ≥99.5% (GC) human pricing
G8270 D-(+)-Glucose ≥99.5% (GC) human pricing
G5767 D-(+)-Glucose ACS reagent human pricing
G7021 D-(+)-Glucose powder, BioReagent, suitable for cell culture, suitable for insect cell culture, suitable for plant cell culture, ≥99.5% human pricing
G5400 D-(+)-Glucose ≥99% (GC) human pricing
G6152 D-(+)-Glucose suitable for mouse embryo cell culture, ≥99.5% (GC) human pricing
G5146 D-(+)-Glucose Hybri-Max, powder, BioReagent, suitable for hybridoma human pricing
G7520 D-(+)-Glucose BioReagent, suitable for plant cell culture human pricing
49139 D-(+)-Glucose BioUltra, anhydrous, ≥99.5% (sum of enantiomers, HPLC) human pricing
16325 D-(+)-Glucose meets analytical specification of Ph. Eur., BP, anhydrous human pricing
RDD016 D-(+)-Glucose anhydrous, free-flowing, Redi-Dri, ≥99.5% human pricing
G8769 D-(+)-Glucose solution 45% in H2O, sterile-filtered, BioXtra, suitable for cell culture human pricing
G8644 D-(+)-Glucose solution 100 g/L in H2O, sterile-filtered, BioXtra, suitable for cell culture human pricing
D2006 Dextrin from corn Type I, powder human pricing
D2131 Dextrin from corn commercial grade, Type II, powder human pricing
D4894 Dextrin from potato starch Type IV, powder human pricing
31400 Dextrin from potato starch for microbiology human pricing
31405 Dextrin from potato starch for biotechnological purposes human pricing
D9434 Dextrose meets EP, BP, JP, USP testing specifications, anhydrous human pricing
D8066 Dextrose meets EP, BP, JP, USP testing specifications human pricing
49163 Glucose solution BioUltra, for molecular biology, ~20% in H2O human pricing
D1542 1,4-Dideoxy-1,4-imino-D-arabinitol hydrochloride enzyme inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005609 Rosetta Predictions human pricing
NM_012638 Rosetta Predictions rat pricing
NM_011224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230562 predicted 3143
2 SASI_Hs01_00230563 predicted 2580
3 SASI_Hs01_00230564 predicted 2123
4 SASI_Hs01_00230565 predicted 1561
5 SASI_Hs01_00230566 predicted 2659
6 SASI_Hs01_00230567 predicted 2448
7 SASI_Hs01_00230568 predicted 1054
8 SASI_Hs01_00230569 predicted 1061
9 SASI_Hs01_00230571 predicted 3138
10 SASI_Hs02_00339927 predicted 2015
11 SASI_Hs01_00230570 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259865 predicted 2374
2 SASI_Rn02_00259866 predicted 2314
3 SASI_Rn02_00259867 predicted 1796
4 SASI_Rn02_00259868 predicted 1787
5 SASI_Rn02_00259869 predicted 793
6 SASI_Rn02_00259870 predicted 2399
7 SASI_Rn02_00259871 predicted 2155
8 SASI_Rn02_00259872 predicted 815
9 SASI_Rn02_00259873 predicted 2235
10 SASI_Rn02_00259874 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047053 predicted 1803
2 SASI_Mm01_00047055 predicted 1729
3 SASI_Mm01_00047056 predicted 791
4 SASI_Mm01_00047057 predicted 2402
5 SASI_Mm02_00320183 predicted 1144
6 SASI_Mm01_00047059 predicted 864
7 SASI_Mm01_00047060 predicted 2565
8 SASI_Mm02_00320184 predicted 967
9 SASI_Mm01_00047061 predicted 1730
10 SASI_Mm01_00047062 predicted 1555
11 SASI_Mm01_00047054 predicted 2390
12 SASI_Mm01_00047058 predicted 1805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011224
PYGM MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen, muscle
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011224.1-2669s21c1
Sequence:CCGGATCTCTACCCTACCCACTTTGCTCGAGCAAAGTGGGTAGGGTAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1244s21c1
Sequence:CCGGCCGCCACTTGCAGATCATTTACTCGAGTAAATGATCTGCAAGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-190s21c1
Sequence:CCGGCTACTCCGAGAGATTACTATTCTCGAGAATAGTAATCTCTCGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011224.1-2655s1c1
Sequence:CCGGGCCTCTGGAATTACATCTCTACTCGAGTAGAGATGTAATTCCAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1842s21c1
Sequence:CCGGTTTATGGTGCCGAGGACTATCCTCGAGGATAGTCCTCGGCACCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-749s1c1
Sequence:CCGGCTATCGGAACAACGTCGTCAACTCGAGTTGACGACGTTGTTCCGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-293s1c1
Sequence:CCGGGAGGATCTACTACCTGTCTTTCTCGAGAAAGACAGGTAGTAGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011224
PYGM MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen, muscle
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011224.1-2669s21c1
Sequence:CCGGATCTCTACCCTACCCACTTTGCTCGAGCAAAGTGGGTAGGGTAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1244s21c1
Sequence:CCGGCCGCCACTTGCAGATCATTTACTCGAGTAAATGATCTGCAAGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-190s21c1
Sequence:CCGGCTACTCCGAGAGATTACTATTCTCGAGAATAGTAATCTCTCGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011224.1-2655s1c1
Sequence:CCGGGCCTCTGGAATTACATCTCTACTCGAGTAGAGATGTAATTCCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1842s21c1
Sequence:CCGGTTTATGGTGCCGAGGACTATCCTCGAGGATAGTCCTCGGCACCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-749s1c1
Sequence:CCGGCTATCGGAACAACGTCGTCAACTCGAGTTGACGACGTTGTTCCGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-293s1c1
Sequence:CCGGGAGGATCTACTACCTGTCTTTCTCGAGAAAGACAGGTAGTAGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011224
PYGM MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen, muscle
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011224.1-2669s21c1
Sequence:CCGGATCTCTACCCTACCCACTTTGCTCGAGCAAAGTGGGTAGGGTAGAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1244s21c1
Sequence:CCGGCCGCCACTTGCAGATCATTTACTCGAGTAAATGATCTGCAAGTGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-190s21c1
Sequence:CCGGCTACTCCGAGAGATTACTATTCTCGAGAATAGTAATCTCTCGGAGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011224.1-2655s1c1
Sequence:CCGGGCCTCTGGAATTACATCTCTACTCGAGTAGAGATGTAATTCCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011224.1-1842s21c1
Sequence:CCGGTTTATGGTGCCGAGGACTATCCTCGAGGATAGTCCTCGGCACCATAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-749s1c1
Sequence:CCGGCTATCGGAACAACGTCGTCAACTCGAGTTGACGACGTTGTTCCGATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011224.1-293s1c1
Sequence:CCGGGAGGATCTACTACCTGTCTTTCTCGAGAAAGACAGGTAGTAGATCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005609
PYGM MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen, muscle
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3143s1c1
Sequence:CCGGGCAGATTATGAAGACTACATTCTCGAGAATGTAGTCTTCATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1072s1c1
Sequence:CCGGCCTGTCTTTAGAGTTCTATATCTCGAGATATAGAACTCTAAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3089s1c1
Sequence:CCGGCTGTTCAAGGACATTGTCAATCTCGAGATTGACAATGTCCTTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-2588s21c1
Sequence:CCGGATCAAGAGGGAGCCCAATAAGCTCGAGCTTATTGGGCTCCCTCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-922s21c1
Sequence:CCGGCCTGCATTTCACACTCGTAAACTCGAGTTTACGAGTGTGAAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-1509s21c1
Sequence:CCGGTGCCTGGCTATCGCAACAATGCTCGAGCATTGTTGCGATAGCCAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-2245s1c1
Sequence:CCGGGCCTCATAAGTTCCAGAATAACTCGAGTTATTCTGGAACTTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1661s1c1
Sequence:CCGGCCCAATGATAATTTCTTCGAACTCGAGTTCGAAGAAATTATCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005609
PYGM MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen, muscle
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3143s1c1
Sequence:CCGGGCAGATTATGAAGACTACATTCTCGAGAATGTAGTCTTCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1072s1c1
Sequence:CCGGCCTGTCTTTAGAGTTCTATATCTCGAGATATAGAACTCTAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3089s1c1
Sequence:CCGGCTGTTCAAGGACATTGTCAATCTCGAGATTGACAATGTCCTTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-2588s21c1
Sequence:CCGGATCAAGAGGGAGCCCAATAAGCTCGAGCTTATTGGGCTCCCTCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-922s21c1
Sequence:CCGGCCTGCATTTCACACTCGTAAACTCGAGTTTACGAGTGTGAAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-1509s21c1
Sequence:CCGGTGCCTGGCTATCGCAACAATGCTCGAGCATTGTTGCGATAGCCAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-2245s1c1
Sequence:CCGGGCCTCATAAGTTCCAGAATAACTCGAGTTATTCTGGAACTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1661s1c1
Sequence:CCGGCCCAATGATAATTTCTTCGAACTCGAGTTCGAAGAAATTATCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005609
PYGM MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen, muscle
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3143s1c1
Sequence:CCGGGCAGATTATGAAGACTACATTCTCGAGAATGTAGTCTTCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1072s1c1
Sequence:CCGGCCTGTCTTTAGAGTTCTATATCTCGAGATATAGAACTCTAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-3089s1c1
Sequence:CCGGCTGTTCAAGGACATTGTCAATCTCGAGATTGACAATGTCCTTGAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-2588s21c1
Sequence:CCGGATCAAGAGGGAGCCCAATAAGCTCGAGCTTATTGGGCTCCCTCTTGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-922s21c1
Sequence:CCGGCCTGCATTTCACACTCGTAAACTCGAGTTTACGAGTGTGAAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005609.2-1509s21c1
Sequence:CCGGTGCCTGGCTATCGCAACAATGCTCGAGCATTGTTGCGATAGCCAGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-2245s1c1
Sequence:CCGGGCCTCATAAGTTCCAGAATAACTCGAGTTATTCTGGAACTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005609.1-1661s1c1
Sequence:CCGGCCCAATGATAATTTCTTCGAACTCGAGTTCGAAGAAATTATCATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)