EMAIL THIS PAGE TO A FRIEND

PYGO1

pygopus homolog 1 (Drosophila)

37 Gene Product Result for
UniProtKB ID: Q9Y3Y4
Gene ID:
Mouse(72135) pygopus 1
Rat(691857) pygopus 1
Zebrafish(797729) pygopus homolog 1 (Drosophila)
chicken(415408) pygopus homolog 1 (Drosophila)
dog(487568) pygopus homolog 1 (Drosophila)
domestic cat(101085723) pygopus homolog 1 (Drosophila)
Horse(100069119) pygopus homolog 1 (Drosophila)
domestic guinea pig(100722086) pygopus homolog 1 (Drosophila)
naked mole-rat(101714662) pygopus homolog 1 (Drosophila)
cow(527394) pygopus homolog 1 (Drosophila)
sheep(101104754) pygopus homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042248 Anti-PYGO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV50601 Anti-PYGO1 antibody produced in rabbit affinity isolated antibody human, horse, bovine, dog, rabbit, guinea pig, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015617 Rosetta Predictions human pricing
XM_001079880 Rosetta Predictions rat pricing
NM_028116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164096 predicted 208
2 SASI_Hs01_00164097 predicted 788
3 SASI_Hs01_00164098 predicted 894
4 SASI_Hs01_00164099 predicted 288
5 SASI_Hs01_00164100 predicted 556
6 SASI_Hs01_00164101 predicted 204
7 SASI_Hs01_00164102 predicted 1032
8 SASI_Hs01_00164103 predicted 1015
9 SASI_Hs01_00164104 predicted 878
10 SASI_Hs01_00164105 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365825 predicted 976
2 SASI_Rn02_00365826 predicted 317
3 SASI_Rn02_00365827 predicted 212
4 SASI_Rn02_00365828 predicted 736
5 SASI_Rn02_00365829 predicted 474
6 SASI_Rn02_00365830 predicted 815
7 SASI_Rn02_00365831 predicted 553
8 SASI_Rn02_00365832 predicted 365
9 SASI_Rn02_00365833 predicted 460
10 SASI_Rn02_00365834 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116647 predicted 1064
2 SASI_Mm01_00116648 predicted 1266
3 SASI_Mm01_00116650 predicted 609
4 SASI_Mm02_00333372 predicted 450
5 SASI_Mm01_00116651 predicted 753
6 SASI_Mm01_00116652 predicted 832
7 SASI_Mm01_00116653 predicted 730
8 SASI_Mm01_00116654 predicted 1293
9 SASI_Mm01_00116655 predicted 1009
10 SASI_Mm01_00116656 predicted 485
11 SASI_Mm01_00116649 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015617
PYGO1 MISSION shRNA Bacterial Glycerol Stock
pygopus homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-199s1c1
Sequence:CCGGGTGGCTGCTAATCCATTTGATCTCGAGATCAAATGGATTAGCAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-253s1c1
Sequence:CCGGCCTTCGTCAAATCCATATCTTCTCGAGAAGATATGGATTTGACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-642s1c1
Sequence:CCGGTCCGTTAGAATCTAATCATTCCTCGAGGAATGATTAGATTCTAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1067s1c1
Sequence:CCGGCCATCTTATGTGAGGCCTCTTCTCGAGAAGAGGCCTCACATAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-296s1c1
Sequence:CCGGGAGGCTATAGTACATTCAGAACTCGAGTTCTGAATGTACTATAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-499s1c1
Sequence:CCGGCAGAATGTCAACATGCCTAATCTCGAGATTAGGCATGTTGACATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1081s1c1
Sequence:CCGGGCCTCTTGTCAGAAATGGTTTCTCGAGAAACCATTTCTGACAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-881s1c1
Sequence:CCGGCCACAAACAATAACCCTGCAACTCGAGTTGCAGGGTTATTGTTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-28s1c1
Sequence:CCGGGCTTACAAAGTTTCCTCGCATCTCGAGATGCGAGGAAACTTTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-465s1c1
Sequence:CCGGTTTCGGTAATCCATCTTATAACTCGAGTTATAAGATGGATTACCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015617
PYGO1 MISSION shRNA shRNA Plasmid DNA
pygopus homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-199s1c1
Sequence:CCGGGTGGCTGCTAATCCATTTGATCTCGAGATCAAATGGATTAGCAGCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000149986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-253s1c1
Sequence:CCGGCCTTCGTCAAATCCATATCTTCTCGAGAAGATATGGATTTGACGAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-642s1c1
Sequence:CCGGTCCGTTAGAATCTAATCATTCCTCGAGGAATGATTAGATTCTAACGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000130684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1067s1c1
Sequence:CCGGCCATCTTATGTGAGGCCTCTTCTCGAGAAGAGGCCTCACATAAGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000129967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-296s1c1
Sequence:CCGGGAGGCTATAGTACATTCAGAACTCGAGTTCTGAATGTACTATAGCCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000128133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-499s1c1
Sequence:CCGGCAGAATGTCAACATGCCTAATCTCGAGATTAGGCATGTTGACATTCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000149202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1081s1c1
Sequence:CCGGGCCTCTTGTCAGAAATGGTTTCTCGAGAAACCATTTCTGACAAGAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000148786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-881s1c1
Sequence:CCGGCCACAAACAATAACCCTGCAACTCGAGTTGCAGGGTTATTGTTTGTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000149475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-28s1c1
Sequence:CCGGGCTTACAAAGTTTCCTCGCATCTCGAGATGCGAGGAAACTTTGTAAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-465s1c1
Sequence:CCGGTTTCGGTAATCCATCTTATAACTCGAGTTATAAGATGGATTACCGAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015617
PYGO1 MISSION shRNA Lentiviral Transduction Particles
pygopus homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-199s1c1
Sequence:CCGGGTGGCTGCTAATCCATTTGATCTCGAGATCAAATGGATTAGCAGCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-253s1c1
Sequence:CCGGCCTTCGTCAAATCCATATCTTCTCGAGAAGATATGGATTTGACGAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-642s1c1
Sequence:CCGGTCCGTTAGAATCTAATCATTCCTCGAGGAATGATTAGATTCTAACGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1067s1c1
Sequence:CCGGCCATCTTATGTGAGGCCTCTTCTCGAGAAGAGGCCTCACATAAGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-296s1c1
Sequence:CCGGGAGGCTATAGTACATTCAGAACTCGAGTTCTGAATGTACTATAGCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-499s1c1
Sequence:CCGGCAGAATGTCAACATGCCTAATCTCGAGATTAGGCATGTTGACATTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-1081s1c1
Sequence:CCGGGCCTCTTGTCAGAAATGGTTTCTCGAGAAACCATTTCTGACAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-881s1c1
Sequence:CCGGCCACAAACAATAACCCTGCAACTCGAGTTGCAGGGTTATTGTTTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-28s1c1
Sequence:CCGGGCTTACAAAGTTTCCTCGCATCTCGAGATGCGAGGAAACTTTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015617.1-465s1c1
Sequence:CCGGTTTCGGTAATCCATCTTATAACTCGAGTTATAAGATGGATTACCGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028116
PYGO1 MISSION shRNA Bacterial Glycerol Stock
pygopus homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-334s21c1
Sequence:CCGGGGGTTAGGAGGGCCCAATATACTCGAGTATATTGGGCCCTCCTAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028116.1-1528s21c1
Sequence:CCGGTCGGCTAACGTGGGTTCATTGCTCGAGCAATGAACCCACGTTAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-711s21c1
Sequence:CCGGGCCGCATGATAATTCGAATTTCTCGAGAAATTCGAATTATCATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-515s21c1
Sequence:GTACCGGTGCCTTCATCTAATCCATATCCTCGAGGATATGGATTAGATGAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-906s21c1
Sequence:CCGGTCCGTTAGAAACGAATCATTCCTCGAGGAATGATTCGTTTCTAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028116
PYGO1 MISSION shRNA shRNA Plasmid DNA
pygopus homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-334s21c1
Sequence:CCGGGGGTTAGGAGGGCCCAATATACTCGAGTATATTGGGCCCTCCTAACCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028116.1-1528s21c1
Sequence:CCGGTCGGCTAACGTGGGTTCATTGCTCGAGCAATGAACCCACGTTAGCCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-711s21c1
Sequence:CCGGGCCGCATGATAATTCGAATTTCTCGAGAAATTCGAATTATCATGCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-515s21c1
Sequence:GTACCGGTGCCTTCATCTAATCCATATCCTCGAGGATATGGATTAGATGAAGGCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-906s21c1
Sequence:CCGGTCCGTTAGAAACGAATCATTCCTCGAGGAATGATTCGTTTCTAACGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028116
PYGO1 MISSION shRNA Lentiviral Transduction Particles
pygopus homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-334s21c1
Sequence:CCGGGGGTTAGGAGGGCCCAATATACTCGAGTATATTGGGCCCTCCTAACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028116.1-1528s21c1
Sequence:CCGGTCGGCTAACGTGGGTTCATTGCTCGAGCAATGAACCCACGTTAGCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-711s21c1
Sequence:CCGGGCCGCATGATAATTCGAATTTCTCGAGAAATTCGAATTATCATGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-515s21c1
Sequence:GTACCGGTGCCTTCATCTAATCCATATCCTCGAGGATATGGATTAGATGAAGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028116.1-906s21c1
Sequence:CCGGTCCGTTAGAAACGAATCATTCCTCGAGGAATGATTCGTTTCTAACGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)