EMAIL THIS PAGE TO A FRIEND

PYGO2

pygopus homolog 2 (Drosophila)

79 Gene Product Result for
Synonyms: 1190004M21Rik
UniProtKB ID: Q9BRQ0, Q8WYZ4, Q96CY2
Gene ID:
Mouse(68911) pygopus 2
Rat(295251) pygopus 2
cow(540401) pygopus homolog 2 (Drosophila)
sheep(101113289) pygopus homolog 2 (Drosophila)
naked mole-rat(101718453) pygopus homolog 2 (Drosophila)
Zebrafish(613247) pygopus homolog 2 (Drosophila)
dog(490440) pygopus homolog 2 (Drosophila)
domestic cat(101096286) pygopus homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138300 Rosetta Predictions human pricing
NM_001106447 Rosetta Predictions rat pricing
NM_026869 Rosetta Predictions mouse pricing
XM_001003051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059018 predicted 1352
2 SASI_Hs01_00059021 predicted 1227
3 SASI_Hs02_00363399 predicted 1464
4 SASI_Hs01_00059022 predicted 1279
5 SASI_Hs01_00059023 predicted 1304
6 SASI_Hs01_00059024 predicted 1203
7 SASI_Hs01_00059025 predicted 1593
8 SASI_Hs01_00059026 predicted 397
9 SASI_Hs01_00059027 predicted 1832
10 SASI_Hs02_00363400 predicted 706
11 SASI_Hs01_00059019 predicted 1632
12 SASI_Hs01_00059020 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219048 predicted 707
2 SASI_Rn02_00219049 predicted 715
3 SASI_Rn02_00219050 predicted 550
4 SASI_Rn02_00219051 predicted 535
5 SASI_Rn02_00219052 predicted 352
6 SASI_Rn02_00219053 predicted 949
7 SASI_Rn02_00219054 predicted 1642
8 SASI_Rn02_00219055 predicted 345
9 SASI_Rn02_00219056 predicted 1119
10 SASI_Rn02_00219057 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331092 predicted 576
2 SASI_Mm02_00331093 predicted 1207
3 SASI_Mm02_00331094 predicted 644
4 SASI_Mm02_00331095 predicted 975
5 SASI_Mm02_00331096 predicted 1228
6 SASI_Mm02_00331097 predicted 377
7 SASI_Mm02_00331098 predicted 375
8 SASI_Mm02_00331099 predicted 372
9 SASI_Mm02_00331100 predicted 638
10 SASI_Mm02_00331101 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275710 predicted 1262
2 SASI_Mm01_00275711 predicted 1526
3 SASI_Mm01_00275712 predicted 1443
4 SASI_Mm01_00275713 predicted 1492
5 SASI_Mm01_00275714 predicted 869
6 SASI_Mm01_00275715 predicted 1555
7 SASI_Mm01_00275716 predicted 939
8 SASI_Mm01_00275717 predicted 1987
9 SASI_Mm01_00275718 predicted 1554
10 SASI_Mm01_00275719 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138300
PYGO2 MISSION shRNA Bacterial Glycerol Stock
pygopus homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-370s21c1
Sequence:CCGGACTCACATCTGACGGAGTTTGCTCGAGCAAACTCCGTCAGATGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-832s21c1
Sequence:CCGGCTTCTCTGTCCCAACGATTTGCTCGAGCAAATCGTTGGGACAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-335s21c1
Sequence:CCGGGAAGCGAAGGAAGTCAAATACCTCGAGGTATTTGACTTCCTTCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138300.3-1466s21c1
Sequence:CCGGCCTGCTCTTCCAGGGTGATTTCTCGAGAAATCACCCTGGAAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-300s1c1
Sequence:CCGGAGAAGCGAAGGAAGTCAAATACTCGAGTATTTGACTTCCTTCGCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-797s1c1
Sequence:CCGGCCTTCTCTGTCCCAACGATTTCTCGAGAAATCGTTGGGACAGAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-1169s1c1
Sequence:CCGGTGTCGGAGTGAGGTGAACGATCTCGAGATCGTTCACCTCACTCCGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-883s1c1
Sequence:CCGGGCCGCCTAACACAAGTCCCTTCTCGAGAAGGGACTTGTGTTAGGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-335s1c1
Sequence:CCGGTACTCACATCTGACGGAGTTTCTCGAGAAACTCCGTCAGATGTGAGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138300
PYGO2 MISSION shRNA shRNA Plasmid DNA
pygopus homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-370s21c1
Sequence:CCGGACTCACATCTGACGGAGTTTGCTCGAGCAAACTCCGTCAGATGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-832s21c1
Sequence:CCGGCTTCTCTGTCCCAACGATTTGCTCGAGCAAATCGTTGGGACAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-335s21c1
Sequence:CCGGGAAGCGAAGGAAGTCAAATACCTCGAGGTATTTGACTTCCTTCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138300.3-1466s21c1
Sequence:CCGGCCTGCTCTTCCAGGGTGATTTCTCGAGAAATCACCCTGGAAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-300s1c1
Sequence:CCGGAGAAGCGAAGGAAGTCAAATACTCGAGTATTTGACTTCCTTCGCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-797s1c1
Sequence:CCGGCCTTCTCTGTCCCAACGATTTCTCGAGAAATCGTTGGGACAGAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-1169s1c1
Sequence:CCGGTGTCGGAGTGAGGTGAACGATCTCGAGATCGTTCACCTCACTCCGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-883s1c1
Sequence:CCGGGCCGCCTAACACAAGTCCCTTCTCGAGAAGGGACTTGTGTTAGGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-335s1c1
Sequence:CCGGTACTCACATCTGACGGAGTTTCTCGAGAAACTCCGTCAGATGTGAGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138300
PYGO2 MISSION shRNA Lentiviral Transduction Particles
pygopus homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-370s21c1
Sequence:CCGGACTCACATCTGACGGAGTTTGCTCGAGCAAACTCCGTCAGATGTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-832s21c1
Sequence:CCGGCTTCTCTGTCCCAACGATTTGCTCGAGCAAATCGTTGGGACAGAGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138300.3-335s21c1
Sequence:CCGGGAAGCGAAGGAAGTCAAATACCTCGAGGTATTTGACTTCCTTCGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138300.3-1466s21c1
Sequence:CCGGCCTGCTCTTCCAGGGTGATTTCTCGAGAAATCACCCTGGAAGAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-300s1c1
Sequence:CCGGAGAAGCGAAGGAAGTCAAATACTCGAGTATTTGACTTCCTTCGCTTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-797s1c1
Sequence:CCGGCCTTCTCTGTCCCAACGATTTCTCGAGAAATCGTTGGGACAGAGAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-1169s1c1
Sequence:CCGGTGTCGGAGTGAGGTGAACGATCTCGAGATCGTTCACCTCACTCCGACATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-883s1c1
Sequence:CCGGGCCGCCTAACACAAGTCCCTTCTCGAGAAGGGACTTGTGTTAGGCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138300.2-335s1c1
Sequence:CCGGTACTCACATCTGACGGAGTTTCTCGAGAAACTCCGTCAGATGTGAGTATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026869
VALIDATED
PYGO2 MISSION shRNA Bacterial Glycerol Stock
pygopus homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1287s21c1
Sequence:CCGGACGATGGGTGACTCTAGTACCCTCGAGGGTACTAGAGTCACCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-287s21c1
Sequence:CCGGGATCATCTGGTCGCTTCTAACCTCGAGGTTAGAAGCGACCAGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1070s21c1
Sequence:CCGGGCCTGCCGTAGTGAGGTAAATCTCGAGATTTACCTCACTACGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-225s21c1
Sequence:CCGGATACTCAGGGTCCTGCATATTCTCGAGAATATGCAGGACCCTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1654s21c1
Sequence:CCGGCCAACACCCGTGCCTACAATACTCGAGTATTGTAGGCACGGGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026869
VALIDATED
PYGO2 MISSION shRNA shRNA Plasmid DNA
pygopus homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1287s21c1
Sequence:CCGGACGATGGGTGACTCTAGTACCCTCGAGGGTACTAGAGTCACCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-287s21c1
Sequence:CCGGGATCATCTGGTCGCTTCTAACCTCGAGGTTAGAAGCGACCAGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1070s21c1
Sequence:CCGGGCCTGCCGTAGTGAGGTAAATCTCGAGATTTACCTCACTACGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-225s21c1
Sequence:CCGGATACTCAGGGTCCTGCATATTCTCGAGAATATGCAGGACCCTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1654s21c1
Sequence:CCGGCCAACACCCGTGCCTACAATACTCGAGTATTGTAGGCACGGGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026869
VALIDATED
PYGO2 MISSION shRNA Lentiviral Transduction Particles
pygopus homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1287s21c1
Sequence:CCGGACGATGGGTGACTCTAGTACCCTCGAGGGTACTAGAGTCACCCATCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-287s21c1
Sequence:CCGGGATCATCTGGTCGCTTCTAACCTCGAGGTTAGAAGCGACCAGATGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1070s21c1
Sequence:CCGGGCCTGCCGTAGTGAGGTAAATCTCGAGATTTACCTCACTACGGCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-225s21c1
Sequence:CCGGATACTCAGGGTCCTGCATATTCTCGAGAATATGCAGGACCCTGAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000238989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026869.2-1654s21c1
Sequence:CCGGCCAACACCCGTGCCTACAATACTCGAGTATTGTAGGCACGGGTGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???