EMAIL THIS PAGE TO A FRIEND

PYHIN1

pyrin and HIN domain family, member 1

89 Gene Product Result for
Synonyms: IFIX RP11-520H16.1
UniProtKB ID: Q6K0P9, Q5T3W6, Q6K0P6, Q6K0P7, Q6K0P8, Q8WW65
Gene ID:
Human(149628) Summary: The protein encoded by this gene belongs to the HIN-200 family of interferon-inducible proteins that share a 200-amino acid signature motif at their C-termini. HIN200 proteins are primarily nuclear and are involved in transcriptional regulation of genes important for cell cycle control, differentiation, and apoptosis. Downregulation of this gene is associated with breast cancer. This protein acts as a tumor suppressor by promoting ubiquitination and subsequent degradation of MDM2, which leads to stabilization of p53/TP53. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(236312) pyrin and HIN domain family, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051224 Anti-PYHIN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152501 Rosetta Predictions human pricing
NM_198928 Rosetta Predictions human pricing
NM_198929 Rosetta Predictions human pricing
NM_198930 Rosetta Predictions human pricing
NM_175026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132245 predicted 804
2 SASI_Hs01_00132246 predicted 1359
3 SASI_Hs02_00366278 predicted 1152
4 SASI_Hs01_00132249 predicted 1259
5 SASI_Hs01_00132251 predicted 1173
6 SASI_Hs01_00132252 predicted 1033
7 SASI_Hs01_00132253 predicted 1126
8 SASI_Hs02_00366279 predicted 879
9 SASI_Hs02_00366280 predicted 1260
10 SASI_Hs01_00132250 predicted 1059
11 SASI_Hs01_00132244 predicted 978
12 SASI_Hs01_00132247 predicted 1148
13 SASI_Hs01_00132248 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061552 predicted 769
2 SASI_Hs01_00061553 predicted 1329
3 SASI_Hs02_00372422 predicted 1121
4 SASI_Hs01_00061556 predicted 1235
5 SASI_Hs01_00061558 predicted 1148
6 SASI_Hs01_00061559 predicted 1011
7 SASI_Hs01_00061560 predicted 1106
8 SASI_Hs02_00372423 predicted 853
9 SASI_Hs02_00372424 predicted 1227
10 SASI_Hs01_00061557 predicted 1028
11 SASI_Hs01_00061551 predicted 959
12 SASI_Hs01_00061554 predicted 1115
13 SASI_Hs01_00061555 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244495 predicted 804
2 SASI_Hs01_00244496 predicted 1359
3 SASI_Hs02_00372425 predicted 1150
4 SASI_Hs01_00244499 predicted 1259
5 SASI_Hs01_00244501 predicted 1178
6 SASI_Hs01_00244502 predicted 1042
7 SASI_Hs01_00244503 predicted 1125
8 SASI_Hs02_00372426 predicted 874
9 SASI_Hs02_00372427 predicted 1252
10 SASI_Hs01_00244500 predicted 1056
11 SASI_Hs01_00244494 predicted 975
12 SASI_Hs01_00244497 predicted 1135
13 SASI_Hs01_00244498 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016188 predicted 771
2 SASI_Hs01_00016189 predicted 1336
3 SASI_Hs02_00372428 predicted 1121
4 SASI_Hs01_00016192 predicted 1228
5 SASI_Hs01_00016194 predicted 1143
6 SASI_Hs01_00016195 predicted 1007
7 SASI_Hs01_00016196 predicted 1101
8 SASI_Hs02_00372429 predicted 847
9 SASI_Hs02_00372430 predicted 1226
10 SASI_Hs01_00016193 predicted 1026
11 SASI_Hs01_00016187 predicted 959
12 SASI_Hs01_00016190 predicted 1115
13 SASI_Hs01_00016191 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345616 predicted 1148
2 SASI_Mm01_00073711 predicted 1036
3 SASI_Mm02_00345617 predicted 1335
4 SASI_Mm01_00073712 predicted 1540
5 SASI_Mm02_00345618 predicted 1184
6 SASI_Mm02_00345619 predicted 1448
7 SASI_Mm01_00073713 predicted 1466
8 SASI_Mm02_00345620 predicted 1326
9 SASI_Mm02_00345621 predicted 1509
10 SASI_Mm02_00345622 predicted 938
11 SASI_Mm01_00073714 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152501
PYHIN1 MISSION shRNA Bacterial Glycerol Stock
pyrin and HIN domain family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1128s1c1
Sequence:CCGGGTTTGAGGTTCCAAAGGACATCTCGAGATGTCCTTTGGAACCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1539s1c1
Sequence:CCGGCCATCTCAAGACTCCTCAGATCTCGAGATCTGAGGAGTCTTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1285s1c1
Sequence:CCGGACAGGAAGTATGGCTGTAGTACTCGAGTACTACAGCCATACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-556s1c1
Sequence:CCGGACGAAACAGAAAGAAGTGTATCTCGAGATACACTTCTTTCTGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-527s1c1
Sequence:CCGGCAGTCAAAGGAATAATCCCATCTCGAGATGGGATTATTCCTTTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1254s21c1
Sequence:CCGGGTAAATAGGAAGACGACAATCCTCGAGGATTGTCGTCTTCCTATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1706s21c1
Sequence:CCGGCCATCCAGCAGTTCCTTAAATCTCGAGATTTAAGGAACTGCTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-888s21c1
Sequence:CCGGATAATCGCGATGGTACTAAATCTCGAGATTTAGTACCATCGCGATTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-846s21c1
Sequence:CCGGCGTCACGCAACTGCCAGTAAACTCGAGTTTACTGGCAGTTGCGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-422s21c1
Sequence:CCGGTGCCGGTTTGGGCAAACTAATCTCGAGATTAGTTTGCCCAAACCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152501
PYHIN1 MISSION shRNA shRNA Plasmid DNA
pyrin and HIN domain family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1128s1c1
Sequence:CCGGGTTTGAGGTTCCAAAGGACATCTCGAGATGTCCTTTGGAACCTCAAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1539s1c1
Sequence:CCGGCCATCTCAAGACTCCTCAGATCTCGAGATCTGAGGAGTCTTGAGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1285s1c1
Sequence:CCGGACAGGAAGTATGGCTGTAGTACTCGAGTACTACAGCCATACTTCCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-556s1c1
Sequence:CCGGACGAAACAGAAAGAAGTGTATCTCGAGATACACTTCTTTCTGTTTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-527s1c1
Sequence:CCGGCAGTCAAAGGAATAATCCCATCTCGAGATGGGATTATTCCTTTGACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1254s21c1
Sequence:CCGGGTAAATAGGAAGACGACAATCCTCGAGGATTGTCGTCTTCCTATTTACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000426871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1706s21c1
Sequence:CCGGCCATCCAGCAGTTCCTTAAATCTCGAGATTTAAGGAACTGCTGGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000429780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-888s21c1
Sequence:CCGGATAATCGCGATGGTACTAAATCTCGAGATTTAGTACCATCGCGATTATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-846s21c1
Sequence:CCGGCGTCACGCAACTGCCAGTAAACTCGAGTTTACTGGCAGTTGCGTGACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-422s21c1
Sequence:CCGGTGCCGGTTTGGGCAAACTAATCTCGAGATTAGTTTGCCCAAACCGGCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152501
PYHIN1 MISSION shRNA Lentiviral Transduction Particles
pyrin and HIN domain family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1128s1c1
Sequence:CCGGGTTTGAGGTTCCAAAGGACATCTCGAGATGTCCTTTGGAACCTCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1539s1c1
Sequence:CCGGCCATCTCAAGACTCCTCAGATCTCGAGATCTGAGGAGTCTTGAGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-1285s1c1
Sequence:CCGGACAGGAAGTATGGCTGTAGTACTCGAGTACTACAGCCATACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-556s1c1
Sequence:CCGGACGAAACAGAAAGAAGTGTATCTCGAGATACACTTCTTTCTGTTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152501.2-527s1c1
Sequence:CCGGCAGTCAAAGGAATAATCCCATCTCGAGATGGGATTATTCCTTTGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1254s21c1
Sequence:CCGGGTAAATAGGAAGACGACAATCCTCGAGGATTGTCGTCTTCCTATTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-1706s21c1
Sequence:CCGGCCATCCAGCAGTTCCTTAAATCTCGAGATTTAAGGAACTGCTGGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-888s21c1
Sequence:CCGGATAATCGCGATGGTACTAAATCTCGAGATTTAGTACCATCGCGATTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-846s21c1
Sequence:CCGGCGTCACGCAACTGCCAGTAAACTCGAGTTTACTGGCAGTTGCGTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152501.3-422s21c1
Sequence:CCGGTGCCGGTTTGGGCAAACTAATCTCGAGATTAGTTTGCCCAAACCGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175026
PYHIN1 MISSION shRNA Bacterial Glycerol Stock
pyrin and HIN domain family, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-925s1c1
Sequence:CCGGTCCTCTAGCAACAATAGCCAACTCGAGTTGGCTATTGTTGCTAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1214s1c1
Sequence:CCGGGCATCTAGTGTGTCAGAGGTACTCGAGTACCTCTGACACACTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-750s1c1
Sequence:CCGGCCATTCAAATTTCTCCAACAACTCGAGTTGTTGGAGAAATTTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1386s1c1
Sequence:CCGGGCTATGAGATAGGAGATGATACTCGAGTATCATCTCCTATCTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175026.1-1590s1c1
Sequence:CCGGGCTTCCTTTATGAAACTGCATCTCGAGATGCAGTTTCATAAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175026
PYHIN1 MISSION shRNA shRNA Plasmid DNA
pyrin and HIN domain family, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-925s1c1
Sequence:CCGGTCCTCTAGCAACAATAGCCAACTCGAGTTGGCTATTGTTGCTAGAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000095203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1214s1c1
Sequence:CCGGGCATCTAGTGTGTCAGAGGTACTCGAGTACCTCTGACACACTAGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000095201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-750s1c1
Sequence:CCGGCCATTCAAATTTCTCCAACAACTCGAGTTGTTGGAGAAATTTGAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000095200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1386s1c1
Sequence:CCGGGCTATGAGATAGGAGATGATACTCGAGTATCATCTCCTATCTCATAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000095199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175026.1-1590s1c1
Sequence:CCGGGCTTCCTTTATGAAACTGCATCTCGAGATGCAGTTTCATAAAGGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175026
PYHIN1 MISSION shRNA Lentiviral Transduction Particles
pyrin and HIN domain family, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-925s1c1
Sequence:CCGGTCCTCTAGCAACAATAGCCAACTCGAGTTGGCTATTGTTGCTAGAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1214s1c1
Sequence:CCGGGCATCTAGTGTGTCAGAGGTACTCGAGTACCTCTGACACACTAGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-750s1c1
Sequence:CCGGCCATTCAAATTTCTCCAACAACTCGAGTTGTTGGAGAAATTTGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175026.1-1386s1c1
Sequence:CCGGGCTATGAGATAGGAGATGATACTCGAGTATCATCTCCTATCTCATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175026.1-1590s1c1
Sequence:CCGGGCTTCCTTTATGAAACTGCATCTCGAGATGCAGTTTCATAAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)