EMAIL THIS PAGE TO A FRIEND

PYURF

PIGY upstream reading frame

16 Gene Product Result for
Synonyms: PREY
UniProtKB ID: Q96I23, B2R571
Gene ID:
Human(100996939) Summary: The product of this gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. This gene represents the protein encoded by the upstream open reading frame, while the protein encoded by the downstream open reading frame is represented by GeneID:84992. [provided by RefSeq, Aug 2012]
Mouse(66459) Pigy upstream reading frame
dog(100996946) PIGY upstream reading frame
cow(100996942) PIGY upstream reading frame
domestic guinea pig(101788063) PIGY upstream reading frame
naked mole-rat(101725651) PIGY upstream reading frame
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019711 MISSION® esiRNA esiRNA targeting mouse Pigy (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328551 predicted 598
2 SASI_Mm01_00135996 predicted 354
3 SASI_Mm01_00135997 predicted 304
4 SASI_Mm02_00328552 predicted 601
5 SASI_Mm01_00135998 predicted 327
6 SASI_Mm01_00135999 predicted 608
7 SASI_Mm01_00136001 predicted 259
8 SASI_Mm01_00136003 predicted 533
9 SASI_Mm01_00136004 predicted 245
10 SASI_Mm01_00136005 predicted 783
11 SASI_Mm01_00136000 predicted 901
12 SASI_Mm01_00136002 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025574
VALIDATED
PYURF MISSION shRNA Bacterial Glycerol Stock
PIGY upstream reading frame
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025574.3-3612s21c1
Sequence:CCGGGGCCATCCTTACCAGTTATTTCTCGAGAAATAACTGGTAAGGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-246s1c1
Sequence:CCGGCTCCAAGAAGCCGCTTAGATACTCGAGTATCTAAGCGGCTTCTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-300s1c1
Sequence:CCGGGTTGGGAATAGCATATCCAATCTCGAGATTGGATATGCTATTCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025574.3-3216s1c1
Sequence:CCGGCATCTAGCTACCCACGTTTATCTCGAGATAAACGTGGGTAGCTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-406s21c1
Sequence:CCGGACCCTAGACCCTGATTGTTAACTCGAGTTAACAATCAGGGTCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-269s21c1
Sequence:CCGGAGATATGAAGCATCGACAAATCTCGAGATTTGTCGATGCTTCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-296s21c1
Sequence:CCGGGTTAATGAAGAGTTGGGAATACTCGAGTATTCCCAACTCTTCATTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-271s1c1
Sequence:CCGGGCATCGACAAATGAATTGGTTCTCGAGAACCAATTCATTTGTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-328s21c1
Sequence:CCGGCATTGATGGGATCCCTAATATCTCGAGATATTAGGGATCCCATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025574
VALIDATED
PYURF MISSION shRNA shRNA Plasmid DNA
PIGY upstream reading frame
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025574.3-3612s21c1
Sequence:CCGGGGCCATCCTTACCAGTTATTTCTCGAGAAATAACTGGTAAGGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-246s1c1
Sequence:CCGGCTCCAAGAAGCCGCTTAGATACTCGAGTATCTAAGCGGCTTCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-300s1c1
Sequence:CCGGGTTGGGAATAGCATATCCAATCTCGAGATTGGATATGCTATTCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025574.3-3216s1c1
Sequence:CCGGCATCTAGCTACCCACGTTTATCTCGAGATAAACGTGGGTAGCTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-406s21c1
Sequence:CCGGACCCTAGACCCTGATTGTTAACTCGAGTTAACAATCAGGGTCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-269s21c1
Sequence:CCGGAGATATGAAGCATCGACAAATCTCGAGATTTGTCGATGCTTCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-296s21c1
Sequence:CCGGGTTAATGAAGAGTTGGGAATACTCGAGTATTCCCAACTCTTCATTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-271s1c1
Sequence:CCGGGCATCGACAAATGAATTGGTTCTCGAGAACCAATTCATTTGTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-328s21c1
Sequence:CCGGCATTGATGGGATCCCTAATATCTCGAGATATTAGGGATCCCATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025574
VALIDATED
PYURF MISSION shRNA Lentiviral Transduction Particles
PIGY upstream reading frame
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025574.3-3612s21c1
Sequence:CCGGGGCCATCCTTACCAGTTATTTCTCGAGAAATAACTGGTAAGGATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-246s1c1
Sequence:CCGGCTCCAAGAAGCCGCTTAGATACTCGAGTATCTAAGCGGCTTCTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-300s1c1
Sequence:CCGGGTTGGGAATAGCATATCCAATCTCGAGATTGGATATGCTATTCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025574.3-3216s1c1
Sequence:CCGGCATCTAGCTACCCACGTTTATCTCGAGATAAACGTGGGTAGCTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-406s21c1
Sequence:CCGGACCCTAGACCCTGATTGTTAACTCGAGTTAACAATCAGGGTCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-269s21c1
Sequence:CCGGAGATATGAAGCATCGACAAATCTCGAGATTTGTCGATGCTTCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-296s21c1
Sequence:CCGGGTTAATGAAGAGTTGGGAATACTCGAGTATTCCCAACTCTTCATTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025574.2-271s1c1
Sequence:CCGGGCATCGACAAATGAATTGGTTCTCGAGAACCAATTCATTTGTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025574.3-328s21c1
Sequence:CCGGCATTGATGGGATCCCTAATATCTCGAGATATTAGGGATCCCATCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)