EMAIL THIS PAGE TO A FRIEND

PYY

peptide YY

58 Gene Product Result for
Synonyms: PYY-I PYY1
UniProtKB ID: P10082, Q5U5Q6, Q6FGH8
Gene ID:
Human(5697) Summary: The protein encoded by this gene is proteolytically processed to release a peptide that inhibits pancreatic secretion and mobility in the gut. Rare variations in this gene could increase susceptibility to obesity. [provided by RefSeq, Jul 2010]
Mouse(217212) peptide YY
Rat(287730) peptide YY (mapped)
dog(607156) peptide YY
cow(615800) peptide YY
sheep(101112405) peptide YY
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004160 Rosetta Predictions human pricing
NM_001034080 Rosetta Predictions rat pricing
NM_145435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101635 predicted 714
2 SASI_Hs01_00101636 predicted 741
3 SASI_Hs01_00101637 predicted 748
4 SASI_Hs01_00101638 predicted 556
5 SASI_Hs02_00337018 predicted 713
6 SASI_Hs01_00101639 predicted 741
7 SASI_Hs02_00337019 predicted 648
8 SASI_Hs01_00101640 predicted 797
9 SASI_Hs01_00101641 predicted 742
10 SASI_Hs01_00101642 predicted 564
11 SASI_Hs01_00101643 predicted 572
12 SASI_Hs01_00101644 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078779 predicted 243
2 SASI_Rn01_00078780 predicted 232
3 SASI_Rn02_00203931 predicted 239
4 SASI_Rn01_00078781 predicted 202
5 SASI_Rn01_00078782 predicted 242
6 SASI_Rn01_00078785 predicted 221
7 SASI_Rn01_00078786 predicted 272
8 SASI_Rn01_00078787 predicted 198
9 SASI_Rn01_00078788 predicted 288
10 SASI_Rn02_00203932 predicted 218
11 SASI_Rn01_00078783 predicted 277
12 SASI_Rn01_00078784 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175826 predicted 207
2 SASI_Mm01_00175827 predicted 207
3 SASI_Mm02_00340805 predicted 250
4 SASI_Mm01_00175828 predicted 205
5 SASI_Mm01_00175829 predicted 205
6 SASI_Mm01_00175830 predicted 240
7 SASI_Mm01_00175831 predicted 253
8 SASI_Mm01_00175832 predicted 252
9 SASI_Mm01_00175834 predicted 368
10 SASI_Mm01_00175835 predicted 190
11 SASI_Mm01_00175833 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004160
PYY MISSION shRNA Bacterial Glycerol Stock
peptide YY
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004160.1-412s1c1
Sequence:CCGGCCCACGTCATTTGCATACGCACTCGAGTGCGTATGCAAATGACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-233s1c1
Sequence:CCGGCCTGCGCCACTACCTCAACCTCTCGAGAGGTTGAGGTAGTGGCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-288s1c2
Sequence:CCGGCCGGACAGGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCCTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-258s1c2
Sequence:CCGGACCCGGCAGCGGTATGGGAAACTCGAGTTTCCCATACCGCTGCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-749s21c1
Sequence:CCGGCCGGACACGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCGTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-864s21c1
Sequence:CCGGCCAACCACGCCCACGTCATTTCTCGAGAAATGACGTGGGCGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-881s21c1
Sequence:CCGGATTTGCATACGCACTCCCGACCTCGAGGTCGGGAGTGCGTATGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-568s21c1
Sequence:CCGGCGCCTTGACCACAGTGCTTCTCTCGAGAGAAGCACTGTGGTCAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004160
PYY MISSION shRNA shRNA Plasmid DNA
peptide YY
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004160.1-412s1c1
Sequence:CCGGCCCACGTCATTTGCATACGCACTCGAGTGCGTATGCAAATGACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-233s1c1
Sequence:CCGGCCTGCGCCACTACCTCAACCTCTCGAGAGGTTGAGGTAGTGGCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-288s1c2
Sequence:CCGGCCGGACAGGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCCTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-258s1c2
Sequence:CCGGACCCGGCAGCGGTATGGGAAACTCGAGTTTCCCATACCGCTGCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-749s21c1
Sequence:CCGGCCGGACACGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCGTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-864s21c1
Sequence:CCGGCCAACCACGCCCACGTCATTTCTCGAGAAATGACGTGGGCGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-881s21c1
Sequence:CCGGATTTGCATACGCACTCCCGACCTCGAGGTCGGGAGTGCGTATGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-568s21c1
Sequence:CCGGCGCCTTGACCACAGTGCTTCTCTCGAGAGAAGCACTGTGGTCAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004160
PYY MISSION shRNA Lentiviral Transduction Particles
peptide YY
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004160.1-412s1c1
Sequence:CCGGCCCACGTCATTTGCATACGCACTCGAGTGCGTATGCAAATGACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-233s1c1
Sequence:CCGGCCTGCGCCACTACCTCAACCTCTCGAGAGGTTGAGGTAGTGGCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-288s1c2
Sequence:CCGGCCGGACAGGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCCTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004160.1-258s1c2
Sequence:CCGGACCCGGCAGCGGTATGGGAAACTCGAGTTTCCCATACCGCTGCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-749s21c1
Sequence:CCGGCCGGACACGCTTCTTTCCAAACTCGAGTTTGGAAAGAAGCGTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-864s21c1
Sequence:CCGGCCAACCACGCCCACGTCATTTCTCGAGAAATGACGTGGGCGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004160.3-881s21c1
Sequence:CCGGATTTGCATACGCACTCCCGACCTCGAGGTCGGGAGTGCGTATGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004160.3-568s21c1
Sequence:CCGGCGCCTTGACCACAGTGCTTCTCTCGAGAGAAGCACTGTGGTCAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145435
PYY MISSION shRNA Bacterial Glycerol Stock
peptide YY
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-244s1c1
Sequence:CCGGCCCGCAGCTCTGTTCTCCAAACTCGAGTTTGGAGAACAGAGCTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-112s1c1
Sequence:CCGGGTGGACGCCTACCCTGCCAAACTCGAGTTTGGCAGGGTAGGCGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-192s1c1
Sequence:CCGGGCGCCACTACCTCAACCTGGTCTCGAGACCAGGTTGAGGTAGTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-66s1c1
Sequence:CCGGCACGGTCGCAATGCTGCTAATCTCGAGATTAGCAGCATTGCGACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-261s1c1
Sequence:CCGGCAAACTGCTCTTCACAGACGACTCGAGTCGTCTGTGAAGAGCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-252s21c1
Sequence:CCGGTCTGTTCTCCAAACTGCTCTTCTCGAGAAGAGCAGTTTGGAGAACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-269s21c1
Sequence:CCGGTCTTCACAGACGACAGCGACACTCGAGTGTCGCTGTCGTCTGTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-74s21c1
Sequence:CCGGCAATGCTGCTAATCCTGCTCGCTCGAGCGAGCAGGATTAGCAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145435
PYY MISSION shRNA shRNA Plasmid DNA
peptide YY
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-244s1c1
Sequence:CCGGCCCGCAGCTCTGTTCTCCAAACTCGAGTTTGGAGAACAGAGCTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-112s1c1
Sequence:CCGGGTGGACGCCTACCCTGCCAAACTCGAGTTTGGCAGGGTAGGCGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-192s1c1
Sequence:CCGGGCGCCACTACCTCAACCTGGTCTCGAGACCAGGTTGAGGTAGTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-66s1c1
Sequence:CCGGCACGGTCGCAATGCTGCTAATCTCGAGATTAGCAGCATTGCGACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-261s1c1
Sequence:CCGGCAAACTGCTCTTCACAGACGACTCGAGTCGTCTGTGAAGAGCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-252s21c1
Sequence:CCGGTCTGTTCTCCAAACTGCTCTTCTCGAGAAGAGCAGTTTGGAGAACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-269s21c1
Sequence:CCGGTCTTCACAGACGACAGCGACACTCGAGTGTCGCTGTCGTCTGTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-74s21c1
Sequence:CCGGCAATGCTGCTAATCCTGCTCGCTCGAGCGAGCAGGATTAGCAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145435
PYY MISSION shRNA Lentiviral Transduction Particles
peptide YY
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-244s1c1
Sequence:CCGGCCCGCAGCTCTGTTCTCCAAACTCGAGTTTGGAGAACAGAGCTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-112s1c1
Sequence:CCGGGTGGACGCCTACCCTGCCAAACTCGAGTTTGGCAGGGTAGGCGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-192s1c1
Sequence:CCGGGCGCCACTACCTCAACCTGGTCTCGAGACCAGGTTGAGGTAGTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-66s1c1
Sequence:CCGGCACGGTCGCAATGCTGCTAATCTCGAGATTAGCAGCATTGCGACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145435.1-261s1c1
Sequence:CCGGCAAACTGCTCTTCACAGACGACTCGAGTCGTCTGTGAAGAGCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-252s21c1
Sequence:CCGGTCTGTTCTCCAAACTGCTCTTCTCGAGAAGAGCAGTTTGGAGAACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-269s21c1
Sequence:CCGGTCTTCACAGACGACAGCGACACTCGAGTGTCGCTGTCGTCTGTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145435.1-74s21c1
Sequence:CCGGCAATGCTGCTAATCCTGCTCGCTCGAGCGAGCAGGATTAGCAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)