EMAIL THIS PAGE TO A FRIEND

QARS

glutaminyl-tRNA synthetase

84 Gene Product Result for
Synonyms: GLNRS PRO2195
UniProtKB ID: P47897
Gene ID:
Human(5859) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. In metazoans, 9 aminoacyl-tRNA synthetases specific for glutamine (gln), glutamic acid (glu), and 7 other amino acids are associated within a multienzyme complex. Although present in eukaryotes, glutaminyl-tRNA synthetase (QARS) is absent from many prokaryotes, mitochondria, and chloroplasts, in which Gln-tRNA(Gln) is formed by transamidation of the misacylated Glu-tRNA(Gln). Glutaminyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(97541) glutaminyl-tRNA synthetase
Rat(290868) glutaminyl-tRNA synthetase
Zebrafish(394188) glutaminyl-tRNA synthetase
chicken(416057) glutaminyl-tRNA synthetase
dog(476628) glutaminyl-tRNA synthetase
domestic cat(101081368) glutaminyl-tRNA synthetase
cow(514586) glutaminyl-tRNA synthetase
sheep(101106974) glutaminyl-tRNA synthetase
naked mole-rat(101702219) glutaminyl-tRNA synthetase
domestic guinea pig(100731498) glutaminyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005051 Rosetta Predictions human pricing
NM_001007624 Rosetta Predictions rat pricing
XM_573963 Rosetta Predictions rat pricing
NM_133794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098546 predicted 1300
2 SASI_Hs01_00098547 predicted 987
3 SASI_Hs01_00098548 predicted 722
4 SASI_Hs01_00098550 predicted 749
5 SASI_Hs01_00098551 predicted 2022
6 SASI_Hs01_00098552 predicted 1465
7 SASI_Hs01_00098553 predicted 1089
8 SASI_Hs01_00098554 predicted 1155
9 SASI_Hs01_00098555 predicted 935
10 SASI_Hs02_00338861 predicted 1486
11 SASI_Hs01_00098549 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089954 predicted 1818
2 SASI_Rn01_00089955 predicted 1086
3 SASI_Rn01_00089956 predicted 1503
4 SASI_Rn02_00198714 predicted 1285
5 SASI_Rn01_00089958 predicted 1413
6 SASI_Rn02_00198715 predicted 1552
7 SASI_Rn01_00089959 predicted 820
8 SASI_Rn01_00089962 predicted 1754
9 SASI_Rn02_00198716 predicted 1835
10 SASI_Rn02_00198717 predicted 1694
11 SASI_Rn01_00089953 predicted 2205
12 SASI_Rn01_00089957 predicted 1227
13 SASI_Rn01_00089960 predicted 1337
14 SASI_Rn01_00089961 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148084 predicted 2198
2 SASI_Rn01_00148085 predicted 1821
3 SASI_Rn01_00148086 predicted 1095
4 SASI_Rn01_00148087 predicted 1513
5 SASI_Rn01_00148088 predicted 1234
6 SASI_Rn01_00148089 predicted 1414
7 SASI_Rn01_00148090 predicted 824
8 SASI_Rn01_00148091 predicted 1336
9 SASI_Rn01_00148092 predicted 1447
10 SASI_Rn01_00148093 predicted 1769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055754 predicted 883
2 SASI_Mm01_00055755 predicted 1599
3 SASI_Mm01_00055756 predicted 1355
4 SASI_Mm01_00055757 predicted 1470
5 SASI_Mm01_00055758 predicted 1341
6 SASI_Mm02_00338819 predicted 1216
7 SASI_Mm01_00055760 predicted 730
8 SASI_Mm01_00055761 predicted 1642
9 SASI_Mm01_00055762 predicted 1157
10 SASI_Mm02_00338820 predicted 1067
11 SASI_Mm01_00055753 predicted 1500
12 SASI_Mm01_00055759 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005051
VALIDATED
QARS MISSION shRNA Bacterial Glycerol Stock
glutaminyl-tRNA synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1094s21c1
Sequence:CCGGGGAGCTCAAAGGCCATAATACCTCGAGGTATTATGGCCTTTGAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2214s1c1
Sequence:CCGGCCCTTCGACAAGTTCCAGTTTCTCGAGAAACTGGAACTTGTCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-744s1c1
Sequence:CCGGCCACACACCATGAATCTACTACTCGAGTAGTAGATTCATGGTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2084s1c1
Sequence:CCGGGCGACTATTCCAGCACAAGAACTCGAGTTCTTGTGCTGGAATAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-977s1c1
Sequence:CCGGGCTAGGCTACACACCTTACAACTCGAGTTGTAAGGTGTGTAGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1253s21c1
Sequence:CCGGAGCCTATCGAGTCAAGTATACCTCGAGGTATACTTGACTCGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2231s21c1
Sequence:CCGGGTTTGAGCGTCTTGGATATTTCTCGAGAAATATCCAAGACGCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2072s21c1
Sequence:CCGGTCGCCTCTATGAGCGACTATTCTCGAGAATAGTCGCTCATAGAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1417s21c1
Sequence:CCGGGCAATGCACTGGACGTCTATTCTCGAGAATAGACGTCCAGTGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005051
VALIDATED
QARS MISSION shRNA shRNA Plasmid DNA
glutaminyl-tRNA synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1094s21c1
Sequence:CCGGGGAGCTCAAAGGCCATAATACCTCGAGGTATTATGGCCTTTGAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2214s1c1
Sequence:CCGGCCCTTCGACAAGTTCCAGTTTCTCGAGAAACTGGAACTTGTCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-744s1c1
Sequence:CCGGCCACACACCATGAATCTACTACTCGAGTAGTAGATTCATGGTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2084s1c1
Sequence:CCGGGCGACTATTCCAGCACAAGAACTCGAGTTCTTGTGCTGGAATAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-977s1c1
Sequence:CCGGGCTAGGCTACACACCTTACAACTCGAGTTGTAAGGTGTGTAGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1253s21c1
Sequence:CCGGAGCCTATCGAGTCAAGTATACCTCGAGGTATACTTGACTCGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2231s21c1
Sequence:CCGGGTTTGAGCGTCTTGGATATTTCTCGAGAAATATCCAAGACGCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2072s21c1
Sequence:CCGGTCGCCTCTATGAGCGACTATTCTCGAGAATAGTCGCTCATAGAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1417s21c1
Sequence:CCGGGCAATGCACTGGACGTCTATTCTCGAGAATAGACGTCCAGTGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005051
VALIDATED
QARS MISSION shRNA Lentiviral Transduction Particles
glutaminyl-tRNA synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1094s21c1
Sequence:CCGGGGAGCTCAAAGGCCATAATACCTCGAGGTATTATGGCCTTTGAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2214s1c1
Sequence:CCGGCCCTTCGACAAGTTCCAGTTTCTCGAGAAACTGGAACTTGTCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-744s1c1
Sequence:CCGGCCACACACCATGAATCTACTACTCGAGTAGTAGATTCATGGTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-2084s1c1
Sequence:CCGGGCGACTATTCCAGCACAAGAACTCGAGTTCTTGTGCTGGAATAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005051.1-977s1c1
Sequence:CCGGGCTAGGCTACACACCTTACAACTCGAGTTGTAAGGTGTGTAGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1253s21c1
Sequence:CCGGAGCCTATCGAGTCAAGTATACCTCGAGGTATACTTGACTCGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2231s21c1
Sequence:CCGGGTTTGAGCGTCTTGGATATTTCTCGAGAAATATCCAAGACGCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-2072s21c1
Sequence:CCGGTCGCCTCTATGAGCGACTATTCTCGAGAATAGTCGCTCATAGAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005051.1-1417s21c1
Sequence:CCGGGCAATGCACTGGACGTCTATTCTCGAGAATAGACGTCCAGTGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133794
VALIDATED
QARS MISSION shRNA Bacterial Glycerol Stock
glutaminyl-tRNA synthetase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-822s21c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-1717s21c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-981s1c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-1717s1c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-822s1c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-2161s1c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-981s21c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-2161s21c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133794
VALIDATED
QARS MISSION shRNA shRNA Plasmid DNA
glutaminyl-tRNA synthetase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-822s21c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-1717s21c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-981s1c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-1717s1c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-822s1c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-2161s1c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-981s21c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-2161s21c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133794
VALIDATED
QARS MISSION shRNA Lentiviral Transduction Particles
glutaminyl-tRNA synthetase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-822s21c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-1717s21c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-981s1c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-1717s1c1
Sequence:CCGGGCTGTTCTAGAGCCACTACAACTCGAGTTGTAGTGGCTCTAGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-822s1c1
Sequence:CCGGGCCCAATGGAATCCTGCATATCTCGAGATATGCAGGATTCCATTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133794.1-2161s1c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-981s21c1
Sequence:CCGGGCTGGGTTATACACCTTACAACTCGAGTTGTAAGGTGTATAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133794.1-2161s21c1
Sequence:CCGGGCGTCACTACAAGTGGTAGAACTCGAGTTCTACCACTTGTAGTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)