EMAIL THIS PAGE TO A FRIEND

QDPR

quinoid dihydropteridine reductase

66 Gene Product Result for
Synonyms: DHPR PKU2 SDR33C1
UniProtKB ID: P09417, A8K158, Q53F52, Q9H3M5
Gene ID:
Human(5860) Summary: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
Mouse(110391) quinoid dihydropteridine reductase
Rat(64192) quinoid dihydropteridine reductase
cow(618084) quinoid dihydropteridine reductase
sheep(101116833) quinoid dihydropteridine reductase
domestic guinea pig(100727648) quinoid dihydropteridine reductase
naked mole-rat(101712596) quinoid dihydropteridine reductase
chicken(426335) quinoid dihydropteridine reductase
domestic cat(101087576) quinoid dihydropteridine reductase
dog(479082) quinoid dihydropteridine reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000320 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000320 Rosetta Predictions human pricing
NM_022390 Rosetta Predictions rat pricing
NM_024236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195826 predicted 687
2 SASI_Hs01_00195827 predicted 913
3 SASI_Hs02_00302329 predicted 634
4 SASI_Hs01_00195828 predicted 509
5 SASI_Hs01_00195829 predicted 1059
6 SASI_Hs01_00195831 predicted 845
7 SASI_Hs01_00195832 predicted 1078
8 SASI_Hs01_00195833 predicted 1017
9 SASI_Hs01_00195834 predicted 356
10 SASI_Hs01_00195835 predicted 1028
11 SASI_Hs01_00195830 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049996 predicted 474
2 SASI_Rn01_00049997 predicted 855
3 SASI_Rn01_00049998 predicted 882
4 SASI_Rn01_00049999 predicted 568
5 SASI_Rn01_00050000 predicted 725
6 SASI_Rn01_00050001 predicted 871
7 SASI_Rn02_00263157 predicted 230
8 SASI_Rn01_00050003 predicted 1076
9 SASI_Rn01_00050004 predicted 786
10 SASI_Rn01_00050005 predicted 608
11 SASI_Rn01_00050002 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177559 predicted 891
2 SASI_Mm02_00327606 predicted 946
3 SASI_Mm01_00177560 predicted 382
4 SASI_Mm01_00177561 predicted 613
5 SASI_Mm01_00177562 predicted 872
6 SASI_Mm01_00177563 predicted 379
7 SASI_Mm01_00177564 predicted 821
8 SASI_Mm01_00177565 predicted 821
9 SASI_Mm01_00177566 predicted 334
10 SASI_Mm01_00177567 predicted 208
11 SASI_Mm01_00177558 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024236
VALIDATED
QDPR MISSION shRNA Bacterial Glycerol Stock
quinoid dihydropteridine reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-768s21c3
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024236.1-817s21c3
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-619s21c2
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-212s21c3
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-732s21c3
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-817s1c1
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-212s1c1
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-768s1c1
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-619s1c1
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024236.1-732s1c1
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024236
VALIDATED
QDPR MISSION shRNA shRNA Plasmid DNA
quinoid dihydropteridine reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-768s21c3
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024236.1-817s21c3
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-619s21c2
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-212s21c3
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-732s21c3
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-817s1c1
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-212s1c1
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-768s1c1
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-619s1c1
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024236.1-732s1c1
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024236
VALIDATED
QDPR MISSION shRNA Lentiviral Transduction Particles
quinoid dihydropteridine reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-768s21c3
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024236.1-817s21c3
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-619s21c2
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-212s21c3
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024236.1-732s21c3
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-817s1c1
Sequence:CCGGGCCCTCTCGAAACATCACTAACTCGAGTTAGTGATGTTTCGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-212s1c1
Sequence:CCGGGTGGTTGTTAAGATGACAGATCTCGAGATCTGTCATCTTAACAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-768s1c1
Sequence:CCGGCAGAGCTTACTCCAGCATATTCTCGAGAATATGCTGGAGTAAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024236.1-619s1c1
Sequence:CCGGCCCGATGAACAGGAAATCAATCTCGAGATTGATTTCCTGTTCATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024236.1-732s1c1
Sequence:CCGGGAAGCCTAATCCAGGTGGTAACTCGAGTTACCACCTGGATTAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000320
VALIDATED
QDPR MISSION shRNA Bacterial Glycerol Stock
quinoid dihydropteridine reductase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-363s1c1
Sequence:CCGGGCCAAATCCAAGTCTCTCTTTCTCGAGAAAGAGAGACTTGGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-318s1c1
Sequence:CCGGGTGGATGCAATTCTTTGCGTTCTCGAGAACGCAAAGAATTGCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-193s1c1
Sequence:CCGGCCAGCGTTGATGTGGTGGAGACTCGAGTCTCCACCACATCAACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-223s1c1
Sequence:CCGGCCAGCGCTACGATCATTGTTACTCGAGTAACAATGATCGTAGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-690s1c1
Sequence:CCGGCCCTTAGAATTCCTAGTTGAACTCGAGTTCAACTAGGAATTCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000320
VALIDATED
QDPR MISSION shRNA shRNA Plasmid DNA
quinoid dihydropteridine reductase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-363s1c1
Sequence:CCGGGCCAAATCCAAGTCTCTCTTTCTCGAGAAAGAGAGACTTGGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-318s1c1
Sequence:CCGGGTGGATGCAATTCTTTGCGTTCTCGAGAACGCAAAGAATTGCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-193s1c1
Sequence:CCGGCCAGCGTTGATGTGGTGGAGACTCGAGTCTCCACCACATCAACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-223s1c1
Sequence:CCGGCCAGCGCTACGATCATTGTTACTCGAGTAACAATGATCGTAGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-690s1c1
Sequence:CCGGCCCTTAGAATTCCTAGTTGAACTCGAGTTCAACTAGGAATTCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000320
VALIDATED
QDPR MISSION shRNA Lentiviral Transduction Particles
quinoid dihydropteridine reductase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-363s1c1
Sequence:CCGGGCCAAATCCAAGTCTCTCTTTCTCGAGAAAGAGAGACTTGGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-318s1c1
Sequence:CCGGGTGGATGCAATTCTTTGCGTTCTCGAGAACGCAAAGAATTGCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-193s1c1
Sequence:CCGGCCAGCGTTGATGTGGTGGAGACTCGAGTCTCCACCACATCAACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000320.1-223s1c1
Sequence:CCGGCCAGCGCTACGATCATTGTTACTCGAGTAACAATGATCGTAGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000320.1-690s1c1
Sequence:CCGGCCCTTAGAATTCCTAGTTGAACTCGAGTTCAACTAGGAATTCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)