EMAIL THIS PAGE TO A FRIEND

QKI

QKI, KH domain containing, RNA binding

390 Gene Product Result for
Synonyms: Hqk QK QK1 QK3 hqkI
Gene ID:
Human(9444) Summary: The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2011]
cow(493722) QKI, KH domain containing, RNA binding
sheep(101113765) QKI, KH domain containing, RNA binding
domestic guinea pig(100723433) QKI, KH domain containing, RNA binding
chicken(374204) QKI, KH domain containing, RNA binding
dog(606754) QKI, KH domain containing, RNA binding
domestic cat(493723) QKI, KH domain containing, RNA binding
Horse(100033866) QKI, KH domain containing, RNA binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019123 Anti-QKI antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701257 Anti-QKI antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500847 Anti-QUAKING/QKI antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
ELISA, western blot pricing
SAB5201536 Monoclonal Anti-Qki (Pan) antibody produced in mouse clone S147-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201545 Monoclonal Anti-Qki - Alkaline Phosphatase antibody produced in mouse clone S147-6, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201546 Monoclonal Anti-Qki - Apc antibody produced in mouse clone S147-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201537 Monoclonal Anti-Qki - Atto 390 antibody produced in mouse clone S147-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201538 Monoclonal Anti-Qki - Atto 488 antibody produced in mouse clone S147-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201539 Monoclonal Anti-Qki - Atto 565 antibody produced in mouse clone S147-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201540 Monoclonal Anti-Qki - Atto 594 antibody produced in mouse clone S147-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201541 Monoclonal Anti-Qki - Atto 633 antibody produced in mouse clone S147-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201542 Monoclonal Anti-Qki - Atto 655 antibody produced in mouse clone S147-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201543 Monoclonal Anti-Qki - Atto 680 antibody produced in mouse clone S147-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201544 Monoclonal Anti-Qki - Atto 700 antibody produced in mouse clone S147-6, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201547 Monoclonal Anti-Qki - Biotin antibody produced in mouse clone S147-6, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201548 Monoclonal Anti-Qki - Fitc antibody produced in mouse clone S147-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201549 Monoclonal Anti-Qki - Hrp antibody produced in mouse clone S147-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201550 Monoclonal Anti-Qki - Pe/Atto 594 antibody produced in mouse clone S147-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201551 Monoclonal Anti-Qki - Percp antibody produced in mouse clone S147-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201552 Monoclonal Anti-Qki - Rpe antibody produced in mouse clone S147-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201553 Monoclonal Anti-Qki - Streptavidin antibody produced in mouse clone S147-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006775 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090851 MISSION® esiRNA esiRNA human QKI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006775 Rosetta Predictions human pricing
NM_206853 Rosetta Predictions human pricing
NM_206854 Rosetta Predictions human pricing
NM_206855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227029 predicted 1212
2 SASI_Hs01_00227030 predicted 1209
3 SASI_Hs01_00227031 predicted 1173
4 SASI_Hs01_00227032 predicted 1153
5 SASI_Hs01_00227033 predicted 1213
6 SASI_Hs01_00227034 predicted 1213
7 SASI_Hs01_00227035 predicted 1155
8 SASI_Hs01_00227036 predicted 1215
9 SASI_Hs01_00227037 predicted 1159
10 SASI_Hs01_00227038 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123199 predicted 1214
2 SASI_Hs01_00123200 predicted 1214
3 SASI_Hs01_00123201 predicted 1173
4 SASI_Hs01_00123202 predicted 1152
5 SASI_Hs01_00123203 predicted 1216
6 SASI_Hs01_00123204 predicted 1209
7 SASI_Hs01_00123205 predicted 1157
8 SASI_Hs01_00123206 predicted 1215
9 SASI_Hs01_00123207 predicted 1158
10 SASI_Hs01_00123208 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124437 predicted 1216
2 SASI_Hs01_00124438 predicted 1213
3 SASI_Hs01_00124439 predicted 1174
4 SASI_Hs01_00124440 predicted 1159
5 SASI_Hs01_00124441 predicted 1214
6 SASI_Hs01_00124442 predicted 1206
7 SASI_Hs01_00124443 predicted 1159
8 SASI_Hs01_00124444 predicted 1216
9 SASI_Hs01_00124445 predicted 1158
10 SASI_Hs01_00124446 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173626 predicted 1208
2 SASI_Hs01_00173627 predicted 1211
3 SASI_Hs01_00173628 predicted 1176
4 SASI_Hs01_00173629 predicted 1152
5 SASI_Hs01_00173630 predicted 1214
6 SASI_Hs01_00173631 predicted 1209
7 SASI_Hs01_00173632 predicted 1155
8 SASI_Hs01_00173633 predicted 1212
9 SASI_Hs01_00173634 predicted 1155
10 SASI_Hs01_00173635 predicted 1159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006775
VALIDATED
QKI MISSION shRNA Bacterial Glycerol Stock
QKI, KH domain containing, RNA binding
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-769s21c1
Sequence:CCGGCTGATGCTGTGGGACCTATTGCTCGAGCAATAGGTCCCACAGCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-891s21c1
Sequence:CCGGGAAGCAGAAACCGGATGTAAACTCGAGTTTACATCCGGTTTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-1387s21c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006775.1-1483s21c1
Sequence:CCGGTAGGTGCGGTGGCTACTAAAGCTCGAGCTTTAGTAGCCACCGCACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-3355s21c1
Sequence:CCGGCTAGCATCATAGTGCATATAACTCGAGTTATATGCACTATGATGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1440s1c1
Sequence:CCGGGCTACATCAATCCTTGAGTATCTCGAGATACTCAAGGATTGATGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1295s1c1
Sequence:CCGGCCCTACCATAATGCCTTTGATCTCGAGATCAAAGGCATTATGGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1387s1c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-687s1c1
Sequence:CCGGGACGAAGAAATTAGCAGAGTACTCGAGTACTCTGCTAATTTCTTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-802s1c1
Sequence:CCGGAGAAACTTTATGTGCCTGTAACTCGAGTTACAGGCACATAAAGTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006775
VALIDATED
QKI MISSION shRNA shRNA Plasmid DNA
QKI, KH domain containing, RNA binding
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-769s21c1
Sequence:CCGGCTGATGCTGTGGGACCTATTGCTCGAGCAATAGGTCCCACAGCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-891s21c1
Sequence:CCGGGAAGCAGAAACCGGATGTAAACTCGAGTTTACATCCGGTTTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-1387s21c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006775.1-1483s21c1
Sequence:CCGGTAGGTGCGGTGGCTACTAAAGCTCGAGCTTTAGTAGCCACCGCACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-3355s21c1
Sequence:CCGGCTAGCATCATAGTGCATATAACTCGAGTTATATGCACTATGATGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1440s1c1
Sequence:CCGGGCTACATCAATCCTTGAGTATCTCGAGATACTCAAGGATTGATGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1295s1c1
Sequence:CCGGCCCTACCATAATGCCTTTGATCTCGAGATCAAAGGCATTATGGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1387s1c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-687s1c1
Sequence:CCGGGACGAAGAAATTAGCAGAGTACTCGAGTACTCTGCTAATTTCTTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-802s1c1
Sequence:CCGGAGAAACTTTATGTGCCTGTAACTCGAGTTACAGGCACATAAAGTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006775
VALIDATED
QKI MISSION shRNA Lentiviral Transduction Particles
QKI, KH domain containing, RNA binding
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-769s21c1
Sequence:CCGGCTGATGCTGTGGGACCTATTGCTCGAGCAATAGGTCCCACAGCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-891s21c1
Sequence:CCGGGAAGCAGAAACCGGATGTAAACTCGAGTTTACATCCGGTTTCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-1387s21c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006775.1-1483s21c1
Sequence:CCGGTAGGTGCGGTGGCTACTAAAGCTCGAGCTTTAGTAGCCACCGCACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006775.1-3355s21c1
Sequence:CCGGCTAGCATCATAGTGCATATAACTCGAGTTATATGCACTATGATGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1440s1c1
Sequence:CCGGGCTACATCAATCCTTGAGTATCTCGAGATACTCAAGGATTGATGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1295s1c1
Sequence:CCGGCCCTACCATAATGCCTTTGATCTCGAGATCAAAGGCATTATGGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-1387s1c1
Sequence:CCGGCCGAAGCTGGTTTAATCTATACTCGAGTATAGATTAAACCAGCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-687s1c1
Sequence:CCGGGACGAAGAAATTAGCAGAGTACTCGAGTACTCTGCTAATTTCTTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006775.1-802s1c1
Sequence:CCGGAGAAACTTTATGTGCCTGTAACTCGAGTTACAGGCACATAAAGTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)