EMAIL THIS PAGE TO A FRIEND

QPCT

glutaminyl-peptide cyclotransferase

63 Gene Product Result for
Synonyms: GCT QC sQC
UniProtKB ID: Q16769, Q16770, Q3KRG6, Q53TR4
Gene ID:
Human(25797) Summary: This gene encodes human pituitary glutaminyl cyclase, which is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides. The amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. [provided by RefSeq, Jul 2008]
Mouse(70536) glutaminyl-peptide cyclotransferase (glutaminyl cyclase)
Rat(83621) glutaminyl-peptide cyclotransferase
chicken(421479) glutaminyl-peptide cyclotransferase
domestic cat(101100635) glutaminyl-peptide cyclotransferase
dog(403861) glutaminyl-peptide cyclotransferase
domestic guinea pig(100718225) glutaminyl-peptide cyclotransferase
naked mole-rat(101707285) glutaminyl-peptide cyclotransferase
cow(281437) glutaminyl-peptide cyclotransferase
sheep(443019) glutaminyl-peptide cyclotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012413 Rosetta Predictions human pricing
NM_027455 Rosetta Predictions mouse pricing
XM_001005187 Rosetta Predictions mouse pricing
XM_898493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092466 predicted 990
2 SASI_Hs01_00092467 predicted 1022
3 SASI_Hs02_00344264 predicted 855
4 SASI_Hs01_00092468 predicted 1203
5 SASI_Hs01_00092469 predicted 1007
6 SASI_Hs01_00092470 predicted 930
7 SASI_Hs02_00344265 predicted 1285
8 SASI_Hs01_00092473 predicted 1004
9 SASI_Hs01_00092474 predicted 852
10 SASI_Hs01_00092475 predicted 1139
11 SASI_Hs01_00092471 predicted 538
12 SASI_Hs01_00092472 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332226 predicted 1494
2 SASI_Mm02_00332227 predicted 1483
3 SASI_Mm02_00332228 predicted 561
4 SASI_Mm02_00332229 predicted 1199
5 SASI_Mm02_00332230 predicted 736
6 SASI_Mm02_00332231 predicted 1507
7 SASI_Mm02_00332232 predicted 1519
8 SASI_Mm02_00332233 predicted 1500
9 SASI_Mm02_00332234 predicted 1424
10 SASI_Mm02_00332235 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226550 predicted 1503
2 SASI_Mm01_00226551 predicted 1479
3 SASI_Mm01_00226552 predicted 1520
4 SASI_Mm01_00226553 predicted 1525
5 SASI_Mm01_00226554 predicted 1486
6 SASI_Mm01_00226555 predicted 1512
7 SASI_Mm01_00226556 predicted 1436
8 SASI_Mm01_00226557 predicted 1395
9 SASI_Mm01_00226558 predicted 1533
10 SASI_Mm01_00226559 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229695 predicted 1595
2 SASI_Mm01_00229696 predicted 1582
3 SASI_Mm01_00229697 predicted 1611
4 SASI_Mm01_00229698 predicted 1625
5 SASI_Mm01_00229699 predicted 1590
6 SASI_Mm01_00229700 predicted 1609
7 SASI_Mm01_00229701 predicted 1525
8 SASI_Mm01_00229702 predicted 1488
9 SASI_Mm01_00229703 predicted 1624
10 SASI_Mm01_00229704 predicted 1674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128770
VALIDATED
QPCT MISSION shRNA Bacterial Glycerol Stock
glutaminyl-peptide cyclotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128770.1-307s1c1
Sequence:CCGGCCATTGCTGATAGAACGATATCTCGAGATATCGTTCTATCAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-1147s1c1
Sequence:CCGGCAAGTCTTTGTGTTGGAATATCTCGAGATATTCCAACACAAAGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-580s1c1
Sequence:CCGGCCATGTGCAATGATGTTGGAACTCGAGTTCCAACATCATTGCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-275s1c1
Sequence:CCGGGCATTTCTGAAATGTGGCAAACTCGAGTTTGCCACATTTCAGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-877s1c1
Sequence:CCGGCCCAAGACTACCAGATGGTTTCTCGAGAAACCATCTGGTAGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128770
VALIDATED
QPCT MISSION shRNA shRNA Plasmid DNA
glutaminyl-peptide cyclotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128770.1-307s1c1
Sequence:CCGGCCATTGCTGATAGAACGATATCTCGAGATATCGTTCTATCAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-1147s1c1
Sequence:CCGGCAAGTCTTTGTGTTGGAATATCTCGAGATATTCCAACACAAAGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-580s1c1
Sequence:CCGGCCATGTGCAATGATGTTGGAACTCGAGTTCCAACATCATTGCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-275s1c1
Sequence:CCGGGCATTTCTGAAATGTGGCAAACTCGAGTTTGCCACATTTCAGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-877s1c1
Sequence:CCGGCCCAAGACTACCAGATGGTTTCTCGAGAAACCATCTGGTAGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128770
VALIDATED
QPCT MISSION shRNA Lentiviral Transduction Particles
glutaminyl-peptide cyclotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128770.1-307s1c1
Sequence:CCGGCCATTGCTGATAGAACGATATCTCGAGATATCGTTCTATCAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-1147s1c1
Sequence:CCGGCAAGTCTTTGTGTTGGAATATCTCGAGATATTCCAACACAAAGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-580s1c1
Sequence:CCGGCCATGTGCAATGATGTTGGAACTCGAGTTCCAACATCATTGCACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-275s1c1
Sequence:CCGGGCATTTCTGAAATGTGGCAAACTCGAGTTTGCCACATTTCAGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128770.1-877s1c1
Sequence:CCGGCCCAAGACTACCAGATGGTTTCTCGAGAAACCATCTGGTAGTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012413
VALIDATED
QPCT MISSION shRNA Bacterial Glycerol Stock
glutaminyl-peptide cyclotransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012413.2-1356s1c1
Sequence:CCGGCCAAGGATCATCATCACGATACTCGAGTATCGTGATGATGATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-224s1c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-965s1c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012413.2-730s1c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-452s1c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-841s21c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-1076s21c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-335s21c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-563s21c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012413
VALIDATED
QPCT MISSION shRNA shRNA Plasmid DNA
glutaminyl-peptide cyclotransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012413.2-1356s1c1
Sequence:CCGGCCAAGGATCATCATCACGATACTCGAGTATCGTGATGATGATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-224s1c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-965s1c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012413.2-730s1c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-452s1c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-841s21c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-1076s21c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-335s21c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-563s21c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012413
VALIDATED
QPCT MISSION shRNA Lentiviral Transduction Particles
glutaminyl-peptide cyclotransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012413.2-1356s1c1
Sequence:CCGGCCAAGGATCATCATCACGATACTCGAGTATCGTGATGATGATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-224s1c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-965s1c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012413.2-730s1c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012413.2-452s1c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-841s21c1
Sequence:CCGGGCATGGATTTATTGGTCTTATCTCGAGATAAGACCAATAAATCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-1076s21c1
Sequence:CCGGGCATCTGATACCGTCTCCTTTCTCGAGAAAGGAGACGGTATCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-335s21c1
Sequence:CCGGGCCATTGCTGATAGAGCGATACTCGAGTATCGCTCTATCAGCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012413.3-563s21c1
Sequence:CCGGCCACTGGAACAACAGAGTGTTCTCGAGAACACTCTGTTGTTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)