EMAIL THIS PAGE TO A FRIEND

QPRT

quinolinate phosphoribosyltransferase

70 Gene Product Result for
Synonyms: QPRTase
UniProtKB ID: Q15274, Q53XW7, Q96G22, Q9BSG6
Gene ID:
Human(23475) Summary: This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. [provided by RefSeq, Jul 2008]
Mouse(67375) quinolinate phosphoribosyltransferase
Rat(293504) quinolinate phosphoribosyltransferase
dog(607664) quinolinate phosphoribosyltransferase
domestic cat(101087441) quinolinate phosphoribosyltransferase
domestic guinea pig(100727900) quinolinate phosphoribosyltransferase
naked mole-rat(101718250) quinolinate phosphoribosyltransferase
cow(614254) quinolinate phosphoribosyltransferase
Goat(100861315) quinolinate phosphoribosyltransferase
sheep(101102696) quinolinate phosphoribosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014298 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118631 MISSION® esiRNA esiRNA human QPRT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014298 Rosetta Predictions human pricing
NM_001009646 Rosetta Predictions rat pricing
NM_133686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013271 predicted 243
2 SASI_Hs01_00013272 predicted 257
3 SASI_Hs01_00013273 predicted 576
4 SASI_Hs01_00013274 predicted 575
5 SASI_Hs01_00013275 predicted 500
6 SASI_Hs01_00013276 predicted 635
7 SASI_Hs01_00013277 predicted 237
8 SASI_Hs01_00013278 predicted 262
9 SASI_Hs01_00013279 predicted 271
10 SASI_Hs01_00013280 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040002 predicted 885
2 SASI_Rn01_00040003 predicted 278
3 SASI_Rn01_00040004 predicted 834
4 SASI_Rn01_00040005 predicted 738
5 SASI_Rn01_00040006 predicted 564
6 SASI_Rn01_00040007 predicted 212
7 SASI_Rn01_00040008 predicted 894
8 SASI_Rn01_00040009 predicted 820
9 SASI_Rn01_00040010 predicted 469
10 SASI_Rn01_00040011 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195365 predicted 931
2 SASI_Mm01_00195367 predicted 828
3 SASI_Mm01_00195368 predicted 691
4 SASI_Mm01_00195369 predicted 737
5 SASI_Mm01_00195370 predicted 475
6 SASI_Mm01_00195371 predicted 519
7 SASI_Mm02_00338645 predicted 222
8 SASI_Mm01_00195373 predicted 268
9 SASI_Mm01_00195374 predicted 536
10 SASI_Mm02_00338646 predicted 562
11 SASI_Mm01_00195366 predicted 213
12 SASI_Mm01_00195372 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133686
QPRT MISSION shRNA Bacterial Glycerol Stock
quinolinate phosphoribosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133686.1-948s1c1
Sequence:CCGGCGAAGAAGATGCCACCAGAATCTCGAGATTCTGGTGGCATCTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-888s1c1
Sequence:CCGGTCCCTCAAACTGTTTGCTGAACTCGAGTTCAGCAAACAGTTTGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-227s1c1
Sequence:CCGGCGCCATCTTCACTCAACTCAACTCGAGTTGAGTTGAGTGAAGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-695s1c1
Sequence:CCGGCCTGGTAATGCTGGACAACTTCTCGAGAAGTTGTCCAGCATTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-704s1c1
Sequence:CCGGGCTGGACAACTTTAAGCCTGACTCGAGTCAGGCTTAAAGTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133686
QPRT MISSION shRNA shRNA Plasmid DNA
quinolinate phosphoribosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133686.1-948s1c1
Sequence:CCGGCGAAGAAGATGCCACCAGAATCTCGAGATTCTGGTGGCATCTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-888s1c1
Sequence:CCGGTCCCTCAAACTGTTTGCTGAACTCGAGTTCAGCAAACAGTTTGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-227s1c1
Sequence:CCGGCGCCATCTTCACTCAACTCAACTCGAGTTGAGTTGAGTGAAGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-695s1c1
Sequence:CCGGCCTGGTAATGCTGGACAACTTCTCGAGAAGTTGTCCAGCATTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-704s1c1
Sequence:CCGGGCTGGACAACTTTAAGCCTGACTCGAGTCAGGCTTAAAGTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133686
QPRT MISSION shRNA Lentiviral Transduction Particles
quinolinate phosphoribosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133686.1-948s1c1
Sequence:CCGGCGAAGAAGATGCCACCAGAATCTCGAGATTCTGGTGGCATCTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-888s1c1
Sequence:CCGGTCCCTCAAACTGTTTGCTGAACTCGAGTTCAGCAAACAGTTTGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-227s1c1
Sequence:CCGGCGCCATCTTCACTCAACTCAACTCGAGTTGAGTTGAGTGAAGATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-695s1c1
Sequence:CCGGCCTGGTAATGCTGGACAACTTCTCGAGAAGTTGTCCAGCATTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133686.1-704s1c1
Sequence:CCGGGCTGGACAACTTTAAGCCTGACTCGAGTCAGGCTTAAAGTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014298
VALIDATED
QPRT MISSION shRNA Bacterial Glycerol Stock
quinolinate phosphoribosyltransferase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-247s1c1
Sequence:CCGGCAGCCTTTCTTCGATGCCATACTCGAGTATGGCATCGAAGAAAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-922s1c1
Sequence:CCGGTCCCTCAAGCTGTTTGCCAAACTCGAGTTTGGCAAACAGCTTGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-261s1c1
Sequence:CCGGTGCCATATTTACCCAACTCAACTCGAGTTGAGTTGGGTAAATATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-580s1c1
Sequence:CCGGGTGATGGTGAAGGATAACCATCTCGAGATGGTTATCCTTCACCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014298.3-909s1c1
Sequence:CCGGAGCCCTTGATTTCTCCCTCAACTCGAGTTGAGGGAGAAATCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-969s21c1
Sequence:CCGGCTAGTCCTAAACCGGAAGAGGCTCGAGCCTCTTCCGGTTTAGGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-657s21c1
Sequence:CCGGCTTCGCTCTGAAGGTGGAAGTCTCGAGACTTCCACCTTCAGAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-248s21c1
Sequence:CCGGAGCCTTTCTTCGATGCCATATCTCGAGATATGGCATCGAAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-167s21c1
Sequence:CCGGTCAACTACGCAGCCTTGGTCACTCGAGTGACCAAGGCTGCGTAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-578s21c1
Sequence:CCGGTGGTGATGGTGAAGGATAACCCTCGAGGGTTATCCTTCACCATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-1147s21c1
Sequence:CCGGGCTCATCTCAGTTTCCTAATCCTCGAGGATTAGGAAACTGAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014298
VALIDATED
QPRT MISSION shRNA shRNA Plasmid DNA
quinolinate phosphoribosyltransferase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-247s1c1
Sequence:CCGGCAGCCTTTCTTCGATGCCATACTCGAGTATGGCATCGAAGAAAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-922s1c1
Sequence:CCGGTCCCTCAAGCTGTTTGCCAAACTCGAGTTTGGCAAACAGCTTGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-261s1c1
Sequence:CCGGTGCCATATTTACCCAACTCAACTCGAGTTGAGTTGGGTAAATATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-580s1c1
Sequence:CCGGGTGATGGTGAAGGATAACCATCTCGAGATGGTTATCCTTCACCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014298.3-909s1c1
Sequence:CCGGAGCCCTTGATTTCTCCCTCAACTCGAGTTGAGGGAGAAATCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-969s21c1
Sequence:CCGGCTAGTCCTAAACCGGAAGAGGCTCGAGCCTCTTCCGGTTTAGGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-657s21c1
Sequence:CCGGCTTCGCTCTGAAGGTGGAAGTCTCGAGACTTCCACCTTCAGAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-248s21c1
Sequence:CCGGAGCCTTTCTTCGATGCCATATCTCGAGATATGGCATCGAAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-167s21c1
Sequence:CCGGTCAACTACGCAGCCTTGGTCACTCGAGTGACCAAGGCTGCGTAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-578s21c1
Sequence:CCGGTGGTGATGGTGAAGGATAACCCTCGAGGGTTATCCTTCACCATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-1147s21c1
Sequence:CCGGGCTCATCTCAGTTTCCTAATCCTCGAGGATTAGGAAACTGAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014298
VALIDATED
QPRT MISSION shRNA Lentiviral Transduction Particles
quinolinate phosphoribosyltransferase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-247s1c1
Sequence:CCGGCAGCCTTTCTTCGATGCCATACTCGAGTATGGCATCGAAGAAAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-922s1c1
Sequence:CCGGTCCCTCAAGCTGTTTGCCAAACTCGAGTTTGGCAAACAGCTTGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-261s1c1
Sequence:CCGGTGCCATATTTACCCAACTCAACTCGAGTTGAGTTGGGTAAATATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014298.3-580s1c1
Sequence:CCGGGTGATGGTGAAGGATAACCATCTCGAGATGGTTATCCTTCACCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014298.3-909s1c1
Sequence:CCGGAGCCCTTGATTTCTCCCTCAACTCGAGTTGAGGGAGAAATCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-969s21c1
Sequence:CCGGCTAGTCCTAAACCGGAAGAGGCTCGAGCCTCTTCCGGTTTAGGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-657s21c1
Sequence:CCGGCTTCGCTCTGAAGGTGGAAGTCTCGAGACTTCCACCTTCAGAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-248s21c1
Sequence:CCGGAGCCTTTCTTCGATGCCATATCTCGAGATATGGCATCGAAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-167s21c1
Sequence:CCGGTCAACTACGCAGCCTTGGTCACTCGAGTGACCAAGGCTGCGTAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-578s21c1
Sequence:CCGGTGGTGATGGTGAAGGATAACCCTCGAGGGTTATCCTTCACCATCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014298.3-1147s21c1
Sequence:CCGGGCTCATCTCAGTTTCCTAATCCTCGAGGATTAGGAAACTGAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)