EMAIL THIS PAGE TO A FRIEND

QRICH1

glutamine-rich 1

91 Gene Product Result for
UniProtKB ID: Q2TAL8, Q4G0F7, Q7L621, Q8TEA5
Gene ID:
Mouse(69232) glutamine-rich 1
Rat(301004) glutamine-rich 1
Zebrafish(336260) glutamine-rich 1
domestic cat(101081124) glutamine-rich 1
dog(476629) glutamine-rich 1
chicken(100858758) glutamine-rich 1
cow(511970) glutamine-rich 1
sheep(101107555) glutamine-rich 1
naked mole-rat(101700081) glutamine-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017730 Rosetta Predictions human pricing
NM_198880 Rosetta Predictions human pricing
NM_001134532 Rosetta Predictions rat pricing
NM_001114119 Rosetta Predictions mouse pricing
NM_175143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125414 predicted 2124
2 SASI_Hs01_00125415 predicted 432
3 SASI_Hs01_00125416 predicted 1079
4 SASI_Hs02_00350515 predicted 2384
5 SASI_Hs01_00125418 predicted 1859
6 SASI_Hs01_00125420 predicted 1842
7 SASI_Hs01_00125421 predicted 2345
8 SASI_Hs01_00125423 predicted 1065
9 SASI_Hs02_00350516 predicted 2323
10 SASI_Hs02_00350517 predicted 1135
11 SASI_Hs01_00125417 predicted 2114
12 SASI_Hs01_00125419 predicted 2355
13 SASI_Hs01_00125422 predicted 1878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196761 predicted 2065
2 SASI_Hs01_00196762 predicted 378
3 SASI_Hs01_00196763 predicted 1013
4 SASI_Hs02_00372380 predicted 2328
5 SASI_Hs01_00196765 predicted 1805
6 SASI_Hs01_00196767 predicted 1779
7 SASI_Hs01_00196768 predicted 2280
8 SASI_Hs01_00196770 predicted 1006
9 SASI_Hs02_00372381 predicted 2264
10 SASI_Hs02_00372382 predicted 1075
11 SASI_Hs01_00196764 predicted 2059
12 SASI_Hs01_00196766 predicted 2298
13 SASI_Hs01_00196769 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256809 predicted 2053
2 SASI_Rn02_00256810 predicted 1951
3 SASI_Rn02_00256811 predicted 1480
4 SASI_Rn02_00256812 predicted 1979
5 SASI_Rn02_00256813 predicted 1279
6 SASI_Rn02_00256814 predicted 2132
7 SASI_Rn02_00256815 predicted 2239
8 SASI_Rn02_00256816 predicted 1891
9 SASI_Rn02_00256817 predicted 2400
10 SASI_Rn02_00256818 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308409 predicted 1136
2 SASI_Mm02_00308410 predicted 1926
3 SASI_Mm02_00308411 predicted 2446
4 SASI_Mm02_00308412 predicted 2195
5 SASI_Mm02_00308413 predicted 858
6 SASI_Mm02_00308414 predicted 1143
7 SASI_Mm02_00308415 predicted 2216
8 SASI_Mm02_00308416 predicted 1721
9 SASI_Mm02_00308417 predicted 2413
10 SASI_Mm02_00308418 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345776 predicted 1009
2 SASI_Mm02_00345777 predicted 1221
3 SASI_Mm02_00345778 predicted 1793
4 SASI_Mm02_00345779 predicted 2316
5 SASI_Mm02_00345780 predicted 2073
6 SASI_Mm01_00125602 predicted 732
7 SASI_Mm01_00125603 predicted 1023
8 SASI_Mm02_00345781 predicted 2097
9 SASI_Mm01_00125604 predicted 1600
10 SASI_Mm02_00345782 predicted 2290
11 SASI_Mm01_00125601 predicted 1389
12 SASI_Mm01_00125605 predicted 1630
13 SASI_Mm01_00125606 predicted 376
14 SASI_Mm01_00125607 predicted 528
15 SASI_Mm01_00125608 predicted 1372
16 SASI_Mm01_00125609 predicted 996
17 SASI_Mm01_00125610 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175143
VALIDATED
QRICH1 MISSION shRNA Bacterial Glycerol Stock
glutamine-rich 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1694s21c1
Sequence:CCGGAGGCGACAGTTGCTACGATTTCTCGAGAAATCGTAGCAACTGTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175143.5-208s21c1
Sequence:CCGGTGAAGAGTACATCCGAGTAAACTCGAGTTTACTCGGATGTACTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1811s21c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1003s21c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-988s1c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175143.2-2084s1c1
Sequence:CCGGGCCGTGTCATTTCTGGGAATTCTCGAGAATTCCCAGAAATGACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1795s1c1
Sequence:CCGGCCCAGATGTACTCTACTACATCTCGAGATGTAGTAGAGTACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175143.2-1727s1c1
Sequence:CCGGGCTGAATTGAATTATGGCCTTCTCGAGAAGGCCATAATTCAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-2860s21c1
Sequence:CCGGACTCGGAATCGGCAAACTTTACTCGAGTAAAGTTTGCCGATTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1796s1c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175143
VALIDATED
QRICH1 MISSION shRNA shRNA Plasmid DNA
glutamine-rich 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1694s21c1
Sequence:CCGGAGGCGACAGTTGCTACGATTTCTCGAGAAATCGTAGCAACTGTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175143.5-208s21c1
Sequence:CCGGTGAAGAGTACATCCGAGTAAACTCGAGTTTACTCGGATGTACTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1811s21c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1003s21c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-988s1c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175143.2-2084s1c1
Sequence:CCGGGCCGTGTCATTTCTGGGAATTCTCGAGAATTCCCAGAAATGACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1795s1c1
Sequence:CCGGCCCAGATGTACTCTACTACATCTCGAGATGTAGTAGAGTACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175143.2-1727s1c1
Sequence:CCGGGCTGAATTGAATTATGGCCTTCTCGAGAAGGCCATAATTCAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-2860s21c1
Sequence:CCGGACTCGGAATCGGCAAACTTTACTCGAGTAAAGTTTGCCGATTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1796s1c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175143
VALIDATED
QRICH1 MISSION shRNA Lentiviral Transduction Particles
glutamine-rich 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1694s21c1
Sequence:CCGGAGGCGACAGTTGCTACGATTTCTCGAGAAATCGTAGCAACTGTCGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175143.5-208s21c1
Sequence:CCGGTGAAGAGTACATCCGAGTAAACTCGAGTTTACTCGGATGTACTCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1811s21c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-1003s21c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-988s1c1
Sequence:CCGGGCAACAGAGTTATGTGTCTTTCTCGAGAAAGACACATAACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175143.2-2084s1c1
Sequence:CCGGGCCGTGTCATTTCTGGGAATTCTCGAGAATTCCCAGAAATGACACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1795s1c1
Sequence:CCGGCCCAGATGTACTCTACTACATCTCGAGATGTAGTAGAGTACATCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175143.2-1727s1c1
Sequence:CCGGGCTGAATTGAATTATGGCCTTCTCGAGAAGGCCATAATTCAATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175143.5-2860s21c1
Sequence:CCGGACTCGGAATCGGCAAACTTTACTCGAGTAAAGTTTGCCGATTCCGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175143.2-1796s1c1
Sequence:CCGGCCAGATGTACTCTACTACATTCTCGAGAATGTAGTAGAGTACATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198880
VALIDATED
QRICH1 MISSION shRNA Bacterial Glycerol Stock
glutamine-rich 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2293s1c1
Sequence:CCGGGCTCTATGATTTCTACCTCTTCTCGAGAAGAGGTAGAAATCATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1890s1c1
Sequence:CCGGCCGATCTTTATTATGTTCGGTCTCGAGACCGAACATAATAAAGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2221s1c1
Sequence:CCGGCCAGAAAGTTACAGATGACATCTCGAGATGTCATCTGTAACTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198880.1-3106s1c1
Sequence:CCGGGCCTAACATTGAGGCCTTAAACTCGAGTTTAAGGCCTCAATGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1574s1c1
Sequence:CCGGCCAGAACTTCTGCTTCCAAATCTCGAGATTTGGAAGCAGAAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-2447s1c1
Sequence:CCGGCGGATCCTGGTGATAAGAGAACTCGAGTTCTCTTATCACCAGGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-389s1c1
Sequence:CCGGGCTGGGTCTTTGCTTGAACTTCTCGAGAAGTTCAAGCAAAGACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-908s1c1
Sequence:CCGGCAACCAGTGAAGAAGCGCAAACTCGAGTTTGCGCTTCTTCACTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1673s1c1
Sequence:CCGGCAGAACAGATTGGCACCCATTCTCGAGAATGGGTGCCAATCTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198880
VALIDATED
QRICH1 MISSION shRNA shRNA Plasmid DNA
glutamine-rich 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2293s1c1
Sequence:CCGGGCTCTATGATTTCTACCTCTTCTCGAGAAGAGGTAGAAATCATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1890s1c1
Sequence:CCGGCCGATCTTTATTATGTTCGGTCTCGAGACCGAACATAATAAAGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2221s1c1
Sequence:CCGGCCAGAAAGTTACAGATGACATCTCGAGATGTCATCTGTAACTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198880.1-3106s1c1
Sequence:CCGGGCCTAACATTGAGGCCTTAAACTCGAGTTTAAGGCCTCAATGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1574s1c1
Sequence:CCGGCCAGAACTTCTGCTTCCAAATCTCGAGATTTGGAAGCAGAAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-2447s1c1
Sequence:CCGGCGGATCCTGGTGATAAGAGAACTCGAGTTCTCTTATCACCAGGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-389s1c1
Sequence:CCGGGCTGGGTCTTTGCTTGAACTTCTCGAGAAGTTCAAGCAAAGACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-908s1c1
Sequence:CCGGCAACCAGTGAAGAAGCGCAAACTCGAGTTTGCGCTTCTTCACTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1673s1c1
Sequence:CCGGCAGAACAGATTGGCACCCATTCTCGAGAATGGGTGCCAATCTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198880
VALIDATED
QRICH1 MISSION shRNA Lentiviral Transduction Particles
glutamine-rich 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2293s1c1
Sequence:CCGGGCTCTATGATTTCTACCTCTTCTCGAGAAGAGGTAGAAATCATAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1890s1c1
Sequence:CCGGCCGATCTTTATTATGTTCGGTCTCGAGACCGAACATAATAAAGATCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-2221s1c1
Sequence:CCGGCCAGAAAGTTACAGATGACATCTCGAGATGTCATCTGTAACTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198880.1-3106s1c1
Sequence:CCGGGCCTAACATTGAGGCCTTAAACTCGAGTTTAAGGCCTCAATGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1574s1c1
Sequence:CCGGCCAGAACTTCTGCTTCCAAATCTCGAGATTTGGAAGCAGAAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-2447s1c1
Sequence:CCGGCGGATCCTGGTGATAAGAGAACTCGAGTTCTCTTATCACCAGGATCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-389s1c1
Sequence:CCGGGCTGGGTCTTTGCTTGAACTTCTCGAGAAGTTCAAGCAAAGACCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_198880.1-908s1c1
Sequence:CCGGCAACCAGTGAAGAAGCGCAAACTCGAGTTTGCGCTTCTTCACTGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198880.1-1673s1c1
Sequence:CCGGCAGAACAGATTGGCACCCATTCTCGAGAATGGGTGCCAATCTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)