EMAIL THIS PAGE TO A FRIEND

QRICH2

glutamine rich 2

56 Gene Product Result for
UniProtKB ID: Q9H0J4, A2RRE1, Q96LM3
Gene ID:
Mouse(217341) glutamine rich 2
Rat(501747) glutamine rich 2
naked mole-rat(101710879) glutamine rich 2
cow(530282) glutamine rich 2
sheep(101117347) glutamine rich 2
chicken(101669111) glutamine rich 2
domestic cat(101097437) glutamine rich 2
dog(475918) glutamine rich 2
chicken(101748865) glutamine rich 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032134 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032134 Rosetta Predictions human pricing
XM_001081721 Rosetta Predictions rat pricing
XM_577148 Rosetta Predictions rat pricing
NM_001033267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193278 predicted 3432
2 SASI_Hs01_00193279 predicted 2473
3 SASI_Hs01_00193281 predicted 1086
4 SASI_Hs01_00193282 predicted 3229
5 SASI_Hs01_00193283 predicted 1207
6 SASI_Hs01_00193284 predicted 998
7 SASI_Hs02_00359357 predicted 1092
8 SASI_Hs01_00193285 predicted 880
9 SASI_Hs01_00193286 predicted 2984
10 SASI_Hs02_00359358 predicted 2755
11 SASI_Hs01_00193280 predicted 672
12 SASI_Hs01_00193287 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373165 predicted 1344
2 SASI_Rn02_00373166 predicted 772
3 SASI_Rn02_00373167 predicted 1658
4 SASI_Rn02_00373168 predicted 376
5 SASI_Rn02_00373169 predicted 377
6 SASI_Rn02_00373170 predicted 874
7 SASI_Rn02_00373171 predicted 371
8 SASI_Rn02_00373172 predicted 1661
9 SASI_Rn02_00373173 predicted 1036
10 SASI_Rn02_00373174 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406262 predicted 1265
2 SASI_Rn02_00406263 predicted 2293
3 SASI_Rn02_00406264 predicted 4700
4 SASI_Rn02_00406265 predicted 5016
5 SASI_Rn02_00406266 predicted 1213
6 SASI_Rn02_00406267 predicted 1852
7 SASI_Rn02_00406268 predicted 5859
8 SASI_Rn02_00406269 predicted 6048
9 SASI_Rn02_00406270 predicted 1750
10 SASI_Rn02_00406271 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070263 predicted 882
2 SASI_Mm02_00288447 predicted 818
3 SASI_Mm01_00070264 predicted 957
4 SASI_Mm01_00070265 predicted 1280
5 SASI_Mm01_00070266 predicted 1332
6 SASI_Mm01_00070267 predicted 724
7 SASI_Mm01_00070268 predicted 1188
8 SASI_Mm01_00070269 predicted 1528
9 SASI_Mm01_00070270 predicted 1266
10 SASI_Mm01_00070271 predicted 1256
11 SASI_Mm01_00070272 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033267
QRICH2 MISSION shRNA Bacterial Glycerol Stock
glutamine rich 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-403s21c1
Sequence:CCGGACAAGCTCAGAACCATCATTGCTCGAGCAATGATGGTTCTGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1486s21c1
Sequence:CCGGTCAGCCACCCATGCTACAAACCTCGAGGTTTGTAGCATGGGTGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1897s21c1
Sequence:CCGGCTCAGAGTGCACAGATGATAGCTCGAGCTATCATCTGTGCACTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-789s21c1
Sequence:CCGGGGGATAGAAAGGCTGGATAAGCTCGAGCTTATCCAGCCTTTCTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-706s21c1
Sequence:CCGGACTGTGAGAAGCTCAACATTACTCGAGTAATGTTGAGCTTCTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033267
QRICH2 MISSION shRNA shRNA Plasmid DNA
glutamine rich 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-403s21c1
Sequence:CCGGACAAGCTCAGAACCATCATTGCTCGAGCAATGATGGTTCTGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1486s21c1
Sequence:CCGGTCAGCCACCCATGCTACAAACCTCGAGGTTTGTAGCATGGGTGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1897s21c1
Sequence:CCGGCTCAGAGTGCACAGATGATAGCTCGAGCTATCATCTGTGCACTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-789s21c1
Sequence:CCGGGGGATAGAAAGGCTGGATAAGCTCGAGCTTATCCAGCCTTTCTATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-706s21c1
Sequence:CCGGACTGTGAGAAGCTCAACATTACTCGAGTAATGTTGAGCTTCTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033267
QRICH2 MISSION shRNA Lentiviral Transduction Particles
glutamine rich 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-403s21c1
Sequence:CCGGACAAGCTCAGAACCATCATTGCTCGAGCAATGATGGTTCTGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1486s21c1
Sequence:CCGGTCAGCCACCCATGCTACAAACCTCGAGGTTTGTAGCATGGGTGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-1897s21c1
Sequence:CCGGCTCAGAGTGCACAGATGATAGCTCGAGCTATCATCTGTGCACTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-789s21c1
Sequence:CCGGGGGATAGAAAGGCTGGATAAGCTCGAGCTTATCCAGCCTTTCTATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033267.2-706s21c1
Sequence:CCGGACTGTGAGAAGCTCAACATTACTCGAGTAATGTTGAGCTTCTCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032134
QRICH2 MISSION shRNA Bacterial Glycerol Stock
glutamine rich 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-1768s1c1
Sequence:CCGGGATCAGATTGATGTGGTGCAACTCGAGTTGCACCACATCAATCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-2809s1c1
Sequence:CCGGCCACCAGAAACTTATCAGCAACTCGAGTTGCTGATAAGTTTCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-3231s1c1
Sequence:CCGGGCGTAGAATGAGTTCTAGTTTCTCGAGAAACTAGAACTCATTCTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-250s1c1
Sequence:CCGGCTATTCAAAGATCGGGAGCAACTCGAGTTGCTCCCGATCTTTGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-389s1c1
Sequence:CCGGGCTCAGAAACACTTATGGGATCTCGAGATCCCATAAGTGTTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032134
QRICH2 MISSION shRNA shRNA Plasmid DNA
glutamine rich 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-1768s1c1
Sequence:CCGGGATCAGATTGATGTGGTGCAACTCGAGTTGCACCACATCAATCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-2809s1c1
Sequence:CCGGCCACCAGAAACTTATCAGCAACTCGAGTTGCTGATAAGTTTCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-3231s1c1
Sequence:CCGGGCGTAGAATGAGTTCTAGTTTCTCGAGAAACTAGAACTCATTCTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-250s1c1
Sequence:CCGGCTATTCAAAGATCGGGAGCAACTCGAGTTGCTCCCGATCTTTGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-389s1c1
Sequence:CCGGGCTCAGAAACACTTATGGGATCTCGAGATCCCATAAGTGTTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032134
QRICH2 MISSION shRNA Lentiviral Transduction Particles
glutamine rich 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-1768s1c1
Sequence:CCGGGATCAGATTGATGTGGTGCAACTCGAGTTGCACCACATCAATCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-2809s1c1
Sequence:CCGGCCACCAGAAACTTATCAGCAACTCGAGTTGCTGATAAGTTTCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-3231s1c1
Sequence:CCGGGCGTAGAATGAGTTCTAGTTTCTCGAGAAACTAGAACTCATTCTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-250s1c1
Sequence:CCGGCTATTCAAAGATCGGGAGCAACTCGAGTTGCTCCCGATCTTTGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032134.1-389s1c1
Sequence:CCGGGCTCAGAAACACTTATGGGATCTCGAGATCCCATAAGTGTTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)