EMAIL THIS PAGE TO A FRIEND

QRSL1

glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1

92 Gene Product Result for
Synonyms: GatA
UniProtKB ID: Q9H0R6, Q5VWJ4, Q9HA60, Q9NV19
Gene ID:
Mouse(76563) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Rat(309911) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Zebrafish(327329) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
domestic cat(101092940) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
dog(475014) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
chicken(421781) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
cow(532822) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
sheep(101120249) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
naked mole-rat(101706522) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Domestic Rabbit(100339740) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
domestic guinea pig(100727562) glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018292 Rosetta Predictions human pricing
NM_001014034 Rosetta Predictions rat pricing
XM_001067712 Rosetta Predictions rat pricing
NM_001081054 Rosetta Predictions mouse pricing
XM_125586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088725 predicted 873
2 SASI_Hs01_00088726 predicted 1132
3 SASI_Hs01_00088727 predicted 347
4 SASI_Hs02_00351683 predicted 739
5 SASI_Hs01_00088729 predicted 921
6 SASI_Hs01_00088731 predicted 954
7 SASI_Hs01_00088732 predicted 213
8 SASI_Hs02_00351684 predicted 878
9 SASI_Hs01_00088733 predicted 1292
10 SASI_Hs02_00351685 predicted 889
11 SASI_Hs01_00088724 predicted 964
12 SASI_Hs01_00088728 predicted 499
13 SASI_Hs01_00088730 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049304 predicted 1177
2 SASI_Rn01_00049305 predicted 1250
3 SASI_Rn01_00049307 predicted 887
4 SASI_Rn01_00049308 predicted 918
5 SASI_Rn02_00201418 predicted 905
6 SASI_Rn01_00049310 predicted 241
7 SASI_Rn02_00201419 predicted 1052
8 SASI_Rn01_00049311 predicted 1550
9 SASI_Rn01_00049313 predicted 912
10 SASI_Rn02_00201420 predicted 984
11 SASI_Rn01_00049306 predicted 1355
12 SASI_Rn01_00049309 predicted 501
13 SASI_Rn01_00049312 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321925 predicted 1204
2 SASI_Rn02_00321926 predicted 914
3 SASI_Rn02_00321927 predicted 942
4 SASI_Rn02_00321928 predicted 1426
5 SASI_Rn02_00321929 predicted 271
6 SASI_Rn02_00321930 predicted 1072
7 SASI_Rn02_00321931 predicted 1583
8 SASI_Rn02_00321932 predicted 937
9 SASI_Rn02_00321933 predicted 1012
10 SASI_Rn02_00321934 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294721 predicted 1498
2 SASI_Mm02_00294722 predicted 1437
3 SASI_Mm02_00294723 predicted 1269
4 SASI_Mm02_00294724 predicted 497
5 SASI_Mm02_00294725 predicted 1507
6 SASI_Mm02_00294726 predicted 205
7 SASI_Mm02_00294727 predicted 728
8 SASI_Mm02_00294728 predicted 939
9 SASI_Mm02_00294729 predicted 561
10 SASI_Mm02_00294730 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251130 predicted 1117
2 SASI_Mm01_00251131 predicted 1276
3 SASI_Mm01_00251132 predicted 504
4 SASI_Mm01_00251133 predicted 217
5 SASI_Mm01_00251134 predicted 278
6 SASI_Mm01_00251135 predicted 731
7 SASI_Mm01_00251136 predicted 950
8 SASI_Mm01_00251137 predicted 576
9 SASI_Mm01_00251138 predicted 1128
10 SASI_Mm01_00251139 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018292
QRSL1 MISSION shRNA Bacterial Glycerol Stock
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-220s21c1
Sequence:CCGGAGTTTCTAAATGCCTACATTACTCGAGTAATGTAGGCATTTAGAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-966s21c1
Sequence:CCGGGAATATCTTGTACCGGAATTACTCGAGTAATTCCGGTACAAGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018292.4-2046s21c1
Sequence:CCGGGACGTACAGAGATTCTATATTCTCGAGAATATAGAATCTCTGTACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1110s1c1
Sequence:CCGGGCATCGAATATGGCAAGATTTCTCGAGAAATCTTGCCATATTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1529s1c1
Sequence:CCGGGCAGTTTATTGGACGTGCGTTCTCGAGAACGCACGTCCAATAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-138s1c1
Sequence:CCGGGCACTGAAACAAGGCCAAATTCTCGAGAATTTGGCCTTGTTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-871s1c1
Sequence:CCGGCCACAGTACATGAACCTATTACTCGAGTAATAGGTTCATGTACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-396s1c1
Sequence:CCGGCCACCTTATAATGCTACAGTACTCGAGTACTGTAGCATTATAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018292
QRSL1 MISSION shRNA shRNA Plasmid DNA
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-220s21c1
Sequence:CCGGAGTTTCTAAATGCCTACATTACTCGAGTAATGTAGGCATTTAGAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-966s21c1
Sequence:CCGGGAATATCTTGTACCGGAATTACTCGAGTAATTCCGGTACAAGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018292.4-2046s21c1
Sequence:CCGGGACGTACAGAGATTCTATATTCTCGAGAATATAGAATCTCTGTACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1110s1c1
Sequence:CCGGGCATCGAATATGGCAAGATTTCTCGAGAAATCTTGCCATATTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1529s1c1
Sequence:CCGGGCAGTTTATTGGACGTGCGTTCTCGAGAACGCACGTCCAATAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-138s1c1
Sequence:CCGGGCACTGAAACAAGGCCAAATTCTCGAGAATTTGGCCTTGTTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-871s1c1
Sequence:CCGGCCACAGTACATGAACCTATTACTCGAGTAATAGGTTCATGTACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-396s1c1
Sequence:CCGGCCACCTTATAATGCTACAGTACTCGAGTACTGTAGCATTATAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018292
QRSL1 MISSION shRNA Lentiviral Transduction Particles
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-220s21c1
Sequence:CCGGAGTTTCTAAATGCCTACATTACTCGAGTAATGTAGGCATTTAGAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018292.4-966s21c1
Sequence:CCGGGAATATCTTGTACCGGAATTACTCGAGTAATTCCGGTACAAGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018292.4-2046s21c1
Sequence:CCGGGACGTACAGAGATTCTATATTCTCGAGAATATAGAATCTCTGTACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1110s1c1
Sequence:CCGGGCATCGAATATGGCAAGATTTCTCGAGAAATCTTGCCATATTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-1529s1c1
Sequence:CCGGGCAGTTTATTGGACGTGCGTTCTCGAGAACGCACGTCCAATAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-138s1c1
Sequence:CCGGGCACTGAAACAAGGCCAAATTCTCGAGAATTTGGCCTTGTTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-871s1c1
Sequence:CCGGCCACAGTACATGAACCTATTACTCGAGTAATAGGTTCATGTACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018292.2-396s1c1
Sequence:CCGGCCACCTTATAATGCTACAGTACTCGAGTACTGTAGCATTATAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081054
QRSL1 MISSION shRNA Bacterial Glycerol Stock
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081054.2-1703s21c1
Sequence:CCGGGGTAGGATGCTGGGATCTTACCTCGAGGTAAGATCCCAGCATCCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-228s21c1
Sequence:CCGGATCAGAAGAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTCTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-1084s21c1
Sequence:CCGGTCAGAAGTAGCATCGAATATGCTCGAGCATATTCGATGCTACTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-733s21c1
Sequence:CCGGGTTTCACGGCACGGCCTTATTCTCGAGAATAAGGCCGTGCCGTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-352s21c1
Sequence:CCGGGAGACAACATGTGCATCAAATCTCGAGATTTGATGCACATGTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081054
QRSL1 MISSION shRNA shRNA Plasmid DNA
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081054.2-1703s21c1
Sequence:CCGGGGTAGGATGCTGGGATCTTACCTCGAGGTAAGATCCCAGCATCCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-228s21c1
Sequence:CCGGATCAGAAGAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTCTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-1084s21c1
Sequence:CCGGTCAGAAGTAGCATCGAATATGCTCGAGCATATTCGATGCTACTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-733s21c1
Sequence:CCGGGTTTCACGGCACGGCCTTATTCTCGAGAATAAGGCCGTGCCGTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-352s21c1
Sequence:CCGGGAGACAACATGTGCATCAAATCTCGAGATTTGATGCACATGTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081054
QRSL1 MISSION shRNA Lentiviral Transduction Particles
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081054.2-1703s21c1
Sequence:CCGGGGTAGGATGCTGGGATCTTACCTCGAGGTAAGATCCCAGCATCCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-228s21c1
Sequence:CCGGATCAGAAGAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTCTTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-1084s21c1
Sequence:CCGGTCAGAAGTAGCATCGAATATGCTCGAGCATATTCGATGCTACTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-733s21c1
Sequence:CCGGGTTTCACGGCACGGCCTTATTCTCGAGAATAAGGCCGTGCCGTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081054.2-352s21c1
Sequence:CCGGGAGACAACATGTGCATCAAATCTCGAGATTTGATGCACATGTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)