EMAIL THIS PAGE TO A FRIEND

QSER1

glutamine and serine rich 1

221 Gene Product Result for
UniProtKB ID: Q2KHR3, Q6ZU30, Q6ZUR5
Gene ID:
Mouse(99003) glutamine and serine rich 1
Rat(311266) glutamine and serine rich 1
domestic guinea pig(100727829) glutamine and serine rich 1
Domestic Rabbit(100338123) glutamine and serine rich 1
naked mole-rat(101714643) glutamine and serine rich 1
cow(537018) glutamine and serine rich 1
sheep(101122625) glutamine and serine rich 1
Zebrafish(324258) glutamine and serine rich 1
domestic cat(101090717) glutamine and serine rich 1
Horse(100057700) glutamine and serine rich 1
dog(483436) glutamine and serine rich 1
chicken(421599) glutamine and serine rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005682 Anti-QSER1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001076786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001076786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001076786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001123327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001123327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001123327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076786 Rosetta Predictions human pricing
NM_024774 Rosetta Predictions human pricing
XM_001079597 Rosetta Predictions rat pricing
XM_230348 Rosetta Predictions rat pricing
NM_001123327 Rosetta Predictions mouse pricing
XM_130565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312054 predicted 2849
2 SASI_Hs02_00312055 predicted 2674
3 SASI_Hs02_00312056 predicted 1364
4 SASI_Hs02_00312057 predicted 3236
5 SASI_Hs02_00312058 predicted 755
6 SASI_Hs02_00312059 predicted 1519
7 SASI_Hs02_00312060 predicted 3767
8 SASI_Hs02_00312061 predicted 934
9 SASI_Hs02_00312062 predicted 2940
10 SASI_Hs02_00312063 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027956 predicted 2408
2 SASI_Hs01_00027957 predicted 2224
3 SASI_Hs01_00027958 predicted 2046
4 SASI_Hs01_00027959 predicted 2613
5 SASI_Hs01_00027960 predicted 2245
6 SASI_Hs01_00027961 predicted 857
7 SASI_Hs01_00027962 predicted 3148
8 SASI_Hs01_00027963 predicted 1027
9 SASI_Hs01_00027964 predicted 2311
10 SASI_Hs01_00027965 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364819 predicted 1239
2 SASI_Rn02_00364820 predicted 4177
3 SASI_Rn02_00364821 predicted 2753
4 SASI_Rn02_00364822 predicted 2837
5 SASI_Rn02_00364823 predicted 3869
6 SASI_Rn02_00364824 predicted 4117
7 SASI_Rn02_00364825 predicted 1963
8 SASI_Rn02_00364826 predicted 2491
9 SASI_Rn02_00364827 predicted 2821
10 SASI_Rn02_00364828 predicted 4335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386154 predicted 852
2 SASI_Rn02_00386155 predicted 1884
3 SASI_Rn02_00386156 predicted 1178
4 SASI_Rn02_00386157 predicted 2363
5 SASI_Rn02_00386158 predicted 2445
6 SASI_Rn02_00386159 predicted 1565
7 SASI_Rn02_00386160 predicted 2099
8 SASI_Rn02_00386161 predicted 926
9 SASI_Rn02_00386162 predicted 2436
10 SASI_Rn02_00386163 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309799 predicted 2066
2 SASI_Mm02_00309800 predicted 3133
3 SASI_Mm02_00309801 predicted 751
4 SASI_Mm02_00309802 predicted 4145
5 SASI_Mm02_00309803 predicted 3039
6 SASI_Mm02_00309804 predicted 900
7 SASI_Mm02_00309805 predicted 1295
8 SASI_Mm02_00309806 predicted 3590
9 SASI_Mm02_00309807 predicted 1205
10 SASI_Mm02_00309808 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218828 predicted 2215
2 SASI_Mm01_00218829 predicted 2398
3 SASI_Mm01_00218830 predicted 1419
4 SASI_Mm01_00218831 predicted 2481
5 SASI_Mm01_00218832 predicted 814
6 SASI_Mm01_00218833 predicted 3495
7 SASI_Mm01_00218834 predicted 2389
8 SASI_Mm01_00218835 predicted 2467
9 SASI_Mm01_00218836 predicted 2944
10 SASI_Mm01_00218837 predicted 3740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001076786
QSER1 MISSION shRNA Bacterial Glycerol Stock
glutamine and serine rich 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000418122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076786.1-5629s21c1
Sequence:CCGGGGCCTTTAGGAACGAAGTTAGCTCGAGCTAACTTCGTTCCTAAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-1313s21c1
Sequence:CCGGCACATAATGTGCCATCTATTGCTCGAGCAATAGATGGCACATTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-893s21c1
Sequence:CCGGAGCACTCCTTACATAGTTATCCTCGAGGATAACTATGTAAGGAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001076786
QSER1 MISSION shRNA shRNA Plasmid DNA
glutamine and serine rich 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000418122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076786.1-5629s21c1
Sequence:CCGGGGCCTTTAGGAACGAAGTTAGCTCGAGCTAACTTCGTTCCTAAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-1313s21c1
Sequence:CCGGCACATAATGTGCCATCTATTGCTCGAGCAATAGATGGCACATTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-893s21c1
Sequence:CCGGAGCACTCCTTACATAGTTATCCTCGAGGATAACTATGTAAGGAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001076786
QSER1 MISSION shRNA Lentiviral Transduction Particles
glutamine and serine rich 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000418122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076786.1-5629s21c1
Sequence:CCGGGGCCTTTAGGAACGAAGTTAGCTCGAGCTAACTTCGTTCCTAAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-1313s21c1
Sequence:CCGGCACATAATGTGCCATCTATTGCTCGAGCAATAGATGGCACATTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076786.1-893s21c1
Sequence:CCGGAGCACTCCTTACATAGTTATCCTCGAGGATAACTATGTAAGGAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024774
VALIDATED
QSER1 MISSION shRNA Bacterial Glycerol Stock
glutamine and serine rich 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-479s1c1
Sequence:CCGGGCTGTTTGCTACTGGACCTTTCTCGAGAAAGGTCCAGTAGCAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4341s1c1
Sequence:CCGGGCCTTAGAGAAGAGCAATGATCTCGAGATCATTGCTCTTCTCTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4396s1c1
Sequence:CCGGGCATGCTAAATGATAACCGAACTCGAGTTCGGTTATCATTTAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-1600s1c1
Sequence:CCGGCCCTTGATCTTAAGAACTCAACTCGAGTTGAGTTCTTAAGATCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-3707s1c1
Sequence:CCGGGCGTGATGAATTTGTGGTAAACTCGAGTTTACCACAAATTCATCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-2616s1c1
Sequence:CCGGGCTCCTGTTGATAGTACATTACTCGAGTAATGTACTATCAACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4605s1c1
Sequence:CCGGGCACAAGAGTTTGCTGTCGATCTCGAGATCGACAGCAAACTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4337s1c1
Sequence:CCGGGCAAGCCTTAGAGAAGAGCAACTCGAGTTGCTCTTCTCTAAGGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024774
VALIDATED
QSER1 MISSION shRNA shRNA Plasmid DNA
glutamine and serine rich 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-479s1c1
Sequence:CCGGGCTGTTTGCTACTGGACCTTTCTCGAGAAAGGTCCAGTAGCAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4341s1c1
Sequence:CCGGGCCTTAGAGAAGAGCAATGATCTCGAGATCATTGCTCTTCTCTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4396s1c1
Sequence:CCGGGCATGCTAAATGATAACCGAACTCGAGTTCGGTTATCATTTAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-1600s1c1
Sequence:CCGGCCCTTGATCTTAAGAACTCAACTCGAGTTGAGTTCTTAAGATCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-3707s1c1
Sequence:CCGGGCGTGATGAATTTGTGGTAAACTCGAGTTTACCACAAATTCATCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-2616s1c1
Sequence:CCGGGCTCCTGTTGATAGTACATTACTCGAGTAATGTACTATCAACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4605s1c1
Sequence:CCGGGCACAAGAGTTTGCTGTCGATCTCGAGATCGACAGCAAACTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4337s1c1
Sequence:CCGGGCAAGCCTTAGAGAAGAGCAACTCGAGTTGCTCTTCTCTAAGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024774
VALIDATED
QSER1 MISSION shRNA Lentiviral Transduction Particles
glutamine and serine rich 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-479s1c1
Sequence:CCGGGCTGTTTGCTACTGGACCTTTCTCGAGAAAGGTCCAGTAGCAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4341s1c1
Sequence:CCGGGCCTTAGAGAAGAGCAATGATCTCGAGATCATTGCTCTTCTCTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4396s1c1
Sequence:CCGGGCATGCTAAATGATAACCGAACTCGAGTTCGGTTATCATTTAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-1600s1c1
Sequence:CCGGCCCTTGATCTTAAGAACTCAACTCGAGTTGAGTTCTTAAGATCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-3707s1c1
Sequence:CCGGGCGTGATGAATTTGTGGTAAACTCGAGTTTACCACAAATTCATCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024774.2-2616s1c1
Sequence:CCGGGCTCCTGTTGATAGTACATTACTCGAGTAATGTACTATCAACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4605s1c1
Sequence:CCGGGCACAAGAGTTTGCTGTCGATCTCGAGATCGACAGCAAACTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024774.2-4337s1c1
Sequence:CCGGGCAAGCCTTAGAGAAGAGCAACTCGAGTTGCTCTTCTCTAAGGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123327
QSER1 MISSION shRNA Bacterial Glycerol Stock
glutamine and serine rich 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-5001s21c1
Sequence:CCGGATGAATGGCAAAGCTTATAATCTCGAGATTATAAGCTTTGCCATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-3029s21c1
Sequence:CCGGCAAGAAACAGTTGACTATAAACTCGAGTTTATAGTCAACTGTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-2069s21c1
Sequence:CCGGTCTTAAGAAGGCAACTAATTTCTCGAGAAATTAGTTGCCTTCTTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-753s21c1
Sequence:CCGGTACCTATCAAGTGCAAGTATTCTCGAGAATACTTGCACTTGATAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123327
QSER1 MISSION shRNA shRNA Plasmid DNA
glutamine and serine rich 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-5001s21c1
Sequence:CCGGATGAATGGCAAAGCTTATAATCTCGAGATTATAAGCTTTGCCATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-3029s21c1
Sequence:CCGGCAAGAAACAGTTGACTATAAACTCGAGTTTATAGTCAACTGTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-2069s21c1
Sequence:CCGGTCTTAAGAAGGCAACTAATTTCTCGAGAAATTAGTTGCCTTCTTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-753s21c1
Sequence:CCGGTACCTATCAAGTGCAAGTATTCTCGAGAATACTTGCACTTGATAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123327
QSER1 MISSION shRNA Lentiviral Transduction Particles
glutamine and serine rich 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-5001s21c1
Sequence:CCGGATGAATGGCAAAGCTTATAATCTCGAGATTATAAGCTTTGCCATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-3029s21c1
Sequence:CCGGCAAGAAACAGTTGACTATAAACTCGAGTTTATAGTCAACTGTTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-2069s21c1
Sequence:CCGGTCTTAAGAAGGCAACTAATTTCTCGAGAAATTAGTTGCCTTCTTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123327.1-753s21c1
Sequence:CCGGTACCTATCAAGTGCAAGTATTCTCGAGAATACTTGCACTTGATAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)