EMAIL THIS PAGE TO A FRIEND

QSOX2

quiescin Q6 sulfhydryl oxidase 2

67 Gene Product Result for
Synonyms: QSCN6L1 SOXN
Gene ID:
Human(169714) Summary: QSOX2 is a member of the sulfhydryl oxidase/quiescin-6 (Q6) family (QSOX1; MIM 603120) that regulates the sensitization of neuroblastoma cells for IFN-gamma (IFNG; MIM 147570)-induced cell death (Wittke et al., 2003 [PubMed 14633699]
Mouse(227638) quiescin Q6 sulfhydryl oxidase 2
Rat(681023) quiescin Q6 sulfhydryl oxidase 2
domestic guinea pig(100722911) quiescin Q6 sulfhydryl oxidase 2
naked mole-rat(101724305) quiescin Q6 sulfhydryl oxidase 2
cow(788063) quiescin Q6 sulfhydryl oxidase 2
sheep(101117322) quiescin Q6 sulfhydryl oxidase 2
Thale Cress(814654) quiescin-sulfhydryl oxidase 2
domestic cat(101092406) quiescin Q6 sulfhydryl oxidase 2
dog(607571) quiescin Q6 sulfhydryl oxidase 2
chicken(417129) quiescin Q6 sulfhydryl oxidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181701 Rosetta Predictions human pricing
NM_001109434 Rosetta Predictions rat pricing
NM_153559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200918 predicted 1142
2 SASI_Hs01_00200919 predicted 1269
3 SASI_Hs01_00200920 predicted 823
4 SASI_Hs01_00200921 predicted 664
5 SASI_Hs01_00200922 predicted 966
6 SASI_Hs01_00200923 predicted 486
7 SASI_Hs01_00200924 predicted 826
8 SASI_Hs01_00200926 predicted 2197
9 SASI_Hs02_00370299 predicted 979
10 SASI_Hs02_00370300 predicted 1497
11 SASI_Hs01_00200917 predicted 480
12 SASI_Hs01_00200925 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248367 predicted 471
2 SASI_Rn02_00248368 predicted 893
3 SASI_Rn02_00248369 predicted 1262
4 SASI_Rn02_00248370 predicted 2139
5 SASI_Rn02_00248371 predicted 2090
6 SASI_Rn02_00248372 predicted 801
7 SASI_Rn02_00248373 predicted 1576
8 SASI_Rn02_00248374 predicted 610
9 SASI_Rn02_00248375 predicted 1137
10 SASI_Rn02_00248376 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113790 predicted 442
2 SASI_Mm01_00113791 predicted 845
3 SASI_Mm01_00113792 predicted 617
4 SASI_Mm01_00113793 predicted 1283
5 SASI_Mm02_00343342 predicted 794
6 SASI_Mm01_00113794 predicted 1918
7 SASI_Mm01_00113795 predicted 1918
8 SASI_Mm01_00113796 predicted 804
9 SASI_Mm01_00113797 predicted 688
10 SASI_Mm01_00113799 predicted 1209
11 SASI_Mm01_00113798 predicted 1968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181701
VALIDATED
QSOX2 MISSION shRNA Bacterial Glycerol Stock
quiescin Q6 sulfhydryl oxidase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1230s1c1
Sequence:CCGGGTCAACAACAAGATGCGGATTCTCGAGAATCCGCATCTTGTTGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-1730s1c1
Sequence:CCGGCGACAACCTCTTAGACACGTACTCGAGTACGTGTCTAAGAGGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1704s1c1
Sequence:CCGGACATTCTTGAAGCAGCACTATCTCGAGATAGTGCTGCTTCAAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-809s1c1
Sequence:CCGGCCCTTCGTGTTACCTGATCTACTCGAGTAGATCAGGTAACACGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-542s1c1
Sequence:CCGGCAGACAGACGATGATTGACTTCTCGAGAAGTCAATCATCGTCTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2443s21c1
Sequence:CCGGGAGTCCAGGCCAGATAGTCTTCTCGAGAAGACTATCTGGCCTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1321s21c1
Sequence:CCGGACCCGTGTTCTCTCTGGAAACCTCGAGGTTTCCAGAGAGAACACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-647s21c1
Sequence:CCGGTGACAACCGTGGCAGCCATTACTCGAGTAATGGCTGCCACGGTTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2191s21c1
Sequence:CCGGTGCCACCTGCAGCTTTAATATCTCGAGATATTAAAGCTGCAGGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1502s21c1
Sequence:CCGGAGAATCCATGGACTCGGTGAACTCGAGTTCACCGAGTCCATGGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181701
VALIDATED
QSOX2 MISSION shRNA shRNA Plasmid DNA
quiescin Q6 sulfhydryl oxidase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1230s1c1
Sequence:CCGGGTCAACAACAAGATGCGGATTCTCGAGAATCCGCATCTTGTTGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-1730s1c1
Sequence:CCGGCGACAACCTCTTAGACACGTACTCGAGTACGTGTCTAAGAGGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1704s1c1
Sequence:CCGGACATTCTTGAAGCAGCACTATCTCGAGATAGTGCTGCTTCAAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-809s1c1
Sequence:CCGGCCCTTCGTGTTACCTGATCTACTCGAGTAGATCAGGTAACACGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-542s1c1
Sequence:CCGGCAGACAGACGATGATTGACTTCTCGAGAAGTCAATCATCGTCTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2443s21c1
Sequence:CCGGGAGTCCAGGCCAGATAGTCTTCTCGAGAAGACTATCTGGCCTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1321s21c1
Sequence:CCGGACCCGTGTTCTCTCTGGAAACCTCGAGGTTTCCAGAGAGAACACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-647s21c1
Sequence:CCGGTGACAACCGTGGCAGCCATTACTCGAGTAATGGCTGCCACGGTTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2191s21c1
Sequence:CCGGTGCCACCTGCAGCTTTAATATCTCGAGATATTAAAGCTGCAGGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1502s21c1
Sequence:CCGGAGAATCCATGGACTCGGTGAACTCGAGTTCACCGAGTCCATGGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181701
VALIDATED
QSOX2 MISSION shRNA Lentiviral Transduction Particles
quiescin Q6 sulfhydryl oxidase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1230s1c1
Sequence:CCGGGTCAACAACAAGATGCGGATTCTCGAGAATCCGCATCTTGTTGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-1730s1c1
Sequence:CCGGCGACAACCTCTTAGACACGTACTCGAGTACGTGTCTAAGAGGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181701.1-1704s1c1
Sequence:CCGGACATTCTTGAAGCAGCACTATCTCGAGATAGTGCTGCTTCAAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-809s1c1
Sequence:CCGGCCCTTCGTGTTACCTGATCTACTCGAGTAGATCAGGTAACACGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181701.1-542s1c1
Sequence:CCGGCAGACAGACGATGATTGACTTCTCGAGAAGTCAATCATCGTCTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2443s21c1
Sequence:CCGGGAGTCCAGGCCAGATAGTCTTCTCGAGAAGACTATCTGGCCTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1321s21c1
Sequence:CCGGACCCGTGTTCTCTCTGGAAACCTCGAGGTTTCCAGAGAGAACACGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-647s21c1
Sequence:CCGGTGACAACCGTGGCAGCCATTACTCGAGTAATGGCTGCCACGGTTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181701.3-2191s21c1
Sequence:CCGGTGCCACCTGCAGCTTTAATATCTCGAGATATTAAAGCTGCAGGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181701.3-1502s21c1
Sequence:CCGGAGAATCCATGGACTCGGTGAACTCGAGTTCACCGAGTCCATGGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153559
VALIDATED
QSOX2 MISSION shRNA Bacterial Glycerol Stock
quiescin Q6 sulfhydryl oxidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-830s1c1
Sequence:CCGGCTGTTACTTGATTTACCCAAACTCGAGTTTGGGTAAATCAAGTAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-446s1c1
Sequence:CCGGCCGCACATATGACATCCACTTCTCGAGAAGTGGATGTCATATGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1208s1c1
Sequence:CCGGCCTGGACAAGATTCCATATAACTCGAGTTATATGGAATCTTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-1665s1c1
Sequence:CCGGGCCTGCCATGAGGAAATTAAACTCGAGTTTAATTTCCTCATGGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1969s1c1
Sequence:CCGGGCTTGAGAATTGGGCCTATTTCTCGAGAAATAGGCCCAATTCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153559
VALIDATED
QSOX2 MISSION shRNA shRNA Plasmid DNA
quiescin Q6 sulfhydryl oxidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-830s1c1
Sequence:CCGGCTGTTACTTGATTTACCCAAACTCGAGTTTGGGTAAATCAAGTAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-446s1c1
Sequence:CCGGCCGCACATATGACATCCACTTCTCGAGAAGTGGATGTCATATGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1208s1c1
Sequence:CCGGCCTGGACAAGATTCCATATAACTCGAGTTATATGGAATCTTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-1665s1c1
Sequence:CCGGGCCTGCCATGAGGAAATTAAACTCGAGTTTAATTTCCTCATGGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1969s1c1
Sequence:CCGGGCTTGAGAATTGGGCCTATTTCTCGAGAAATAGGCCCAATTCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153559
VALIDATED
QSOX2 MISSION shRNA Lentiviral Transduction Particles
quiescin Q6 sulfhydryl oxidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-830s1c1
Sequence:CCGGCTGTTACTTGATTTACCCAAACTCGAGTTTGGGTAAATCAAGTAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-446s1c1
Sequence:CCGGCCGCACATATGACATCCACTTCTCGAGAAGTGGATGTCATATGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1208s1c1
Sequence:CCGGCCTGGACAAGATTCCATATAACTCGAGTTATATGGAATCTTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153559.1-1665s1c1
Sequence:CCGGGCCTGCCATGAGGAAATTAAACTCGAGTTTAATTTCCTCATGGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153559.1-1969s1c1
Sequence:CCGGGCTTGAGAATTGGGCCTATTTCTCGAGAAATAGGCCCAATTCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)