EMAIL THIS PAGE TO A FRIEND

QTRT1

queuine tRNA-ribosyltransferase 1

55 Gene Product Result for
Synonyms: FP3235 TGT TGUT
UniProtKB ID: Q9BXR0, Q96BQ4, Q9BXQ9
Gene ID:
Human(81890) Summary: This gene encodes the catalytic subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine and tyrosine. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Feb 2012]
Mouse(60507) queuine tRNA-ribosyltransferase 1
Rat(64016) queuine tRNA-ribosyltransferase 1
Zebrafish(393985) queuine tRNA-ribosyltransferase 1
Horse(100057666) queuine tRNA-ribosyltransferase 1
domestic cat(101096292) queuine tRNA-ribosyltransferase 1
dog(476711) queuine tRNA-ribosyltransferase 1
cow(505497) queuine tRNA-ribosyltransferase 1
sheep(101119045) queuine tRNA-ribosyltransferase 1
naked mole-rat(101725775) queuine tRNA-ribosyltransferase 1
domestic guinea pig(100723403) queuine tRNA-ribosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219041 MISSION® esiRNA esiRNA targeting human QTRT1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031209 Rosetta Predictions human pricing
NM_022250 Rosetta Predictions rat pricing
NM_021888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048080 predicted 409
2 SASI_Hs01_00048081 predicted 785
3 SASI_Hs01_00048082 predicted 478
4 SASI_Hs01_00048083 predicted 415
5 SASI_Hs01_00048084 predicted 285
6 SASI_Hs01_00048085 predicted 994
7 SASI_Hs01_00048086 predicted 564
8 SASI_Hs01_00048087 predicted 331
9 SASI_Hs01_00048088 predicted 574
10 SASI_Hs01_00048089 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091957 predicted 400
2 SASI_Rn02_00263031 predicted 1122
3 SASI_Rn01_00091959 predicted 564
4 SASI_Rn01_00091962 predicted 641
5 SASI_Rn01_00091963 predicted 303
6 SASI_Rn02_00263032 predicted 827
7 SASI_Rn01_00091965 predicted 560
8 SASI_Rn02_00263033 predicted 395
9 SASI_Rn02_00263034 predicted 332
10 SASI_Rn02_00263035 predicted 322
11 SASI_Rn01_00091958 predicted 1265
12 SASI_Rn01_00091960 predicted 1214
13 SASI_Rn01_00091961 predicted 1119
14 SASI_Rn01_00091964 predicted 467
15 SASI_Rn01_00091966 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037982 predicted 472
2 SASI_Mm01_00037983 predicted 405
3 SASI_Mm01_00037984 predicted 313
4 SASI_Mm02_00326451 predicted 905
5 SASI_Mm02_00326452 predicted 564
6 SASI_Mm01_00037985 predicted 633
7 SASI_Mm01_00037986 predicted 577
8 SASI_Mm02_00326453 predicted 339
9 SASI_Mm01_00037987 predicted 884
10 SASI_Mm01_00037988 predicted 327
11 SASI_Mm01_00037989 predicted 818
12 SASI_Mm01_00037990 predicted 695
13 SASI_Mm01_00037991 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031209
VALIDATED
QTRT1 MISSION shRNA Bacterial Glycerol Stock
queuine tRNA-ribosyltransferase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-349s21c1
Sequence:CCGGTTTCCAGATGGTGTCGCTGGTCTCGAGACCAGCGACACCATCTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-292s21c1
Sequence:CCGGCAACGGTCTCCACGGCTTCATCTCGAGATGAAGCCGTGGAGACCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-936s21c1
Sequence:CCGGAGGTGTTTGAGAAGGACTTCGCTCGAGCGAAGTCCTTCTCAAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-542s21c1
Sequence:CCGGGAGGCCATGTACAGGTCAATCCTCGAGGATTGACCTGTACATGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-814s21c1
Sequence:CCGGTGCCACTGATCTGGTAGTCTGCTCGAGCAGACTACCAGATCAGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-423s1c1
Sequence:CCGGCCCGGAGAAATCCGTGCAGATCTCGAGATCTGCACGGATTTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-287s1c1
Sequence:CCGGGCTTCATGAATTGGCCTCATACTCGAGTATGAGGCCAATTCATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-903s1c1
Sequence:CCGGGCAGTTGAGGAAGAAGGTGTTCTCGAGAACACCTTCTTCCTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-588s1c1
Sequence:CCGGGCAGAACCTCTTCGCCATTATCTCGAGATAATGGCGAAGAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031209.1-300s1c1
Sequence:CCGGGCCTCATAATCTGCTAACGGACTCGAGTCCGTTAGCAGATTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-281s21c1
Sequence:CCGGATCCAGAAAGCCAACGGTCTCCTCGAGGAGACCGTTGGCTTTCTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031209
VALIDATED
QTRT1 MISSION shRNA shRNA Plasmid DNA
queuine tRNA-ribosyltransferase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-349s21c1
Sequence:CCGGTTTCCAGATGGTGTCGCTGGTCTCGAGACCAGCGACACCATCTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-292s21c1
Sequence:CCGGCAACGGTCTCCACGGCTTCATCTCGAGATGAAGCCGTGGAGACCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-936s21c1
Sequence:CCGGAGGTGTTTGAGAAGGACTTCGCTCGAGCGAAGTCCTTCTCAAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-542s21c1
Sequence:CCGGGAGGCCATGTACAGGTCAATCCTCGAGGATTGACCTGTACATGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-814s21c1
Sequence:CCGGTGCCACTGATCTGGTAGTCTGCTCGAGCAGACTACCAGATCAGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-423s1c1
Sequence:CCGGCCCGGAGAAATCCGTGCAGATCTCGAGATCTGCACGGATTTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-287s1c1
Sequence:CCGGGCTTCATGAATTGGCCTCATACTCGAGTATGAGGCCAATTCATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-903s1c1
Sequence:CCGGGCAGTTGAGGAAGAAGGTGTTCTCGAGAACACCTTCTTCCTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-588s1c1
Sequence:CCGGGCAGAACCTCTTCGCCATTATCTCGAGATAATGGCGAAGAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031209.1-300s1c1
Sequence:CCGGGCCTCATAATCTGCTAACGGACTCGAGTCCGTTAGCAGATTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-281s21c1
Sequence:CCGGATCCAGAAAGCCAACGGTCTCCTCGAGGAGACCGTTGGCTTTCTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031209
VALIDATED
QTRT1 MISSION shRNA Lentiviral Transduction Particles
queuine tRNA-ribosyltransferase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-349s21c1
Sequence:CCGGTTTCCAGATGGTGTCGCTGGTCTCGAGACCAGCGACACCATCTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-292s21c1
Sequence:CCGGCAACGGTCTCCACGGCTTCATCTCGAGATGAAGCCGTGGAGACCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-936s21c1
Sequence:CCGGAGGTGTTTGAGAAGGACTTCGCTCGAGCGAAGTCCTTCTCAAACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-542s21c1
Sequence:CCGGGAGGCCATGTACAGGTCAATCCTCGAGGATTGACCTGTACATGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-814s21c1
Sequence:CCGGTGCCACTGATCTGGTAGTCTGCTCGAGCAGACTACCAGATCAGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-423s1c1
Sequence:CCGGCCCGGAGAAATCCGTGCAGATCTCGAGATCTGCACGGATTTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-287s1c1
Sequence:CCGGGCTTCATGAATTGGCCTCATACTCGAGTATGAGGCCAATTCATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031209.1-903s1c1
Sequence:CCGGGCAGTTGAGGAAGAAGGTGTTCTCGAGAACACCTTCTTCCTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031209.1-588s1c1
Sequence:CCGGGCAGAACCTCTTCGCCATTATCTCGAGATAATGGCGAAGAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031209.1-300s1c1
Sequence:CCGGGCCTCATAATCTGCTAACGGACTCGAGTCCGTTAGCAGATTATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031209.2-281s21c1
Sequence:CCGGATCCAGAAAGCCAACGGTCTCCTCGAGGAGACCGTTGGCTTTCTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021888
VALIDATED
QTRT1 MISSION shRNA Bacterial Glycerol Stock
queuine tRNA-ribosyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1049s21c1
Sequence:CCGGACCTAACCGTGCACAACATTGCTCGAGCAATGTTGTGCACGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-48s21c1
Sequence:CCGGTGAGTCCGCTCCACGAATAATCTCGAGATTATTCGTGGAGCGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021888.2-798s21c1
Sequence:CCGGGGTTGGCTATGCCACCGATTTCTCGAGAAATCGGTGGCATAGCCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-968s1c1
Sequence:CCGGCTACAGCACTACACCACCTAACTCGAGTTAGGTGGTGTAGTGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-567s21c1
Sequence:CCGGCAGATGCATCGCAGCCCATAACTCGAGTTATGGGCTGCGATGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1138s21c1
Sequence:CCGGCGAAACTTCATGCGCACTATGCTCGAGCATAGTGCGCATGAAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-406s1c1
Sequence:CCGGTCGGACATCATCATGCAGTTACTCGAGTAACTGCATGATGATGTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-526s1c1
Sequence:CCGGCCGGACAAGCAGAACCTCTTTCTCGAGAAAGAGGTTCTGCTTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-657s1c1
Sequence:CCGGCAAGGCACAGTTCTGGAAGATCTCGAGATCTTCCAGAACTGTGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-850s1c1
Sequence:CCGGCAGTTGAAGAAGAAGCAGTATCTCGAGATACTGCTTCTTCTTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021888
VALIDATED
QTRT1 MISSION shRNA shRNA Plasmid DNA
queuine tRNA-ribosyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1049s21c1
Sequence:CCGGACCTAACCGTGCACAACATTGCTCGAGCAATGTTGTGCACGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-48s21c1
Sequence:CCGGTGAGTCCGCTCCACGAATAATCTCGAGATTATTCGTGGAGCGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021888.2-798s21c1
Sequence:CCGGGGTTGGCTATGCCACCGATTTCTCGAGAAATCGGTGGCATAGCCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-968s1c1
Sequence:CCGGCTACAGCACTACACCACCTAACTCGAGTTAGGTGGTGTAGTGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-567s21c1
Sequence:CCGGCAGATGCATCGCAGCCCATAACTCGAGTTATGGGCTGCGATGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1138s21c1
Sequence:CCGGCGAAACTTCATGCGCACTATGCTCGAGCATAGTGCGCATGAAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-406s1c1
Sequence:CCGGTCGGACATCATCATGCAGTTACTCGAGTAACTGCATGATGATGTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-526s1c1
Sequence:CCGGCCGGACAAGCAGAACCTCTTTCTCGAGAAAGAGGTTCTGCTTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-657s1c1
Sequence:CCGGCAAGGCACAGTTCTGGAAGATCTCGAGATCTTCCAGAACTGTGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-850s1c1
Sequence:CCGGCAGTTGAAGAAGAAGCAGTATCTCGAGATACTGCTTCTTCTTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021888
VALIDATED
QTRT1 MISSION shRNA Lentiviral Transduction Particles
queuine tRNA-ribosyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1049s21c1
Sequence:CCGGACCTAACCGTGCACAACATTGCTCGAGCAATGTTGTGCACGGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-48s21c1
Sequence:CCGGTGAGTCCGCTCCACGAATAATCTCGAGATTATTCGTGGAGCGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021888.2-798s21c1
Sequence:CCGGGGTTGGCTATGCCACCGATTTCTCGAGAAATCGGTGGCATAGCCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-968s1c1
Sequence:CCGGCTACAGCACTACACCACCTAACTCGAGTTAGGTGGTGTAGTGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-567s21c1
Sequence:CCGGCAGATGCATCGCAGCCCATAACTCGAGTTATGGGCTGCGATGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021888.2-1138s21c1
Sequence:CCGGCGAAACTTCATGCGCACTATGCTCGAGCATAGTGCGCATGAAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-406s1c1
Sequence:CCGGTCGGACATCATCATGCAGTTACTCGAGTAACTGCATGATGATGTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-526s1c1
Sequence:CCGGCCGGACAAGCAGAACCTCTTTCTCGAGAAAGAGGTTCTGCTTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021888.1-657s1c1
Sequence:CCGGCAAGGCACAGTTCTGGAAGATCTCGAGATCTTCCAGAACTGTGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021888.1-850s1c1
Sequence:CCGGCAGTTGAAGAAGAAGCAGTATCTCGAGATACTGCTTCTTCTTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)