EMAIL THIS PAGE TO A FRIEND

R3HCC1L

R3H domain and coiled-coil containing 1-like

135 Gene Product Result for
Synonyms: C10orf28 GIDRP86 GIDRP88 PSORT
UniProtKB ID: Q7Z5L2, O60598, Q5W0B4, Q5W0B5, Q86VT9, Q8N9H0
Gene ID:
Mouse(52013) R3H domain and coiled-coil containing 1 like
Rat(293953) R3H domain and coiled-coil containing 1-like
domestic guinea pig(100722406) R3H domain and coiled-coil containing 1-like
naked mole-rat(101708137) R3H domain and coiled-coil containing 1-like
cow(616788) R3H domain and coiled-coil containing 1-like
sheep(101117125) R3H domain and coiled-coil containing 1-like
Zebrafish(561802) R3H domain and coiled-coil containing 1-like
domestic cat(101082522) R3H domain and coiled-coil containing 1-like
dog(486829) R3H domain and coiled-coil containing 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014472 Rosetta Predictions human pricing
XM_001055620 Rosetta Predictions rat pricing
XM_219870 Rosetta Predictions rat pricing
NM_177464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345705 predicted 405
2 SASI_Hs02_00345706 predicted 2143
3 SASI_Hs01_00112445 predicted 757
4 SASI_Hs01_00112446 predicted 2217
5 SASI_Hs01_00112447 predicted 1898
6 SASI_Hs01_00112448 predicted 1841
7 SASI_Hs01_00112449 predicted 1219
8 SASI_Hs01_00112450 predicted 2636
9 SASI_Hs02_00345707 predicted 1499
10 SASI_Hs01_00112452 predicted 2299
11 SASI_Hs01_00112444 predicted 2074
12 SASI_Hs01_00112451 predicted 1835
13 SASI_Hs01_00112453 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280362 predicted 2345
2 SASI_Rn02_00280363 predicted 1095
3 SASI_Rn02_00280364 predicted 671
4 SASI_Rn02_00280365 predicted 779
5 SASI_Rn02_00280366 predicted 684
6 SASI_Rn02_00280367 predicted 1491
7 SASI_Rn02_00280368 predicted 1660
8 SASI_Rn02_00280369 predicted 1293
9 SASI_Rn02_00280370 predicted 1530
10 SASI_Rn02_00280371 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378799 predicted 1904
2 SASI_Rn02_00378800 predicted 1101
3 SASI_Rn02_00378801 predicted 681
4 SASI_Rn02_00378802 predicted 793
5 SASI_Rn02_00378803 predicted 692
6 SASI_Rn02_00378804 predicted 1496
7 SASI_Rn02_00378805 predicted 1667
8 SASI_Rn02_00378806 predicted 1299
9 SASI_Rn02_00378807 predicted 1537
10 SASI_Rn02_00378808 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080675 predicted 982
2 SASI_Mm01_00080676 predicted 1322
3 SASI_Mm02_00347665 predicted 1106
4 SASI_Mm01_00080677 predicted 1212
5 SASI_Mm02_00347666 predicted 236
6 SASI_Mm01_00080680 predicted 1717
7 SASI_Mm01_00080681 predicted 1781
8 SASI_Mm01_00080678 predicted 291
9 SASI_Mm01_00080682 predicted 2026
10 SASI_Mm01_00080684 predicted 1582
11 SASI_Mm01_00080679 predicted 1882
12 SASI_Mm01_00080683 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177464
VALIDATED
R3HCC1L MISSION shRNA Bacterial Glycerol Stock
R3H domain and coiled-coil containing 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1615s21c1
Sequence:CCGGAGAGGCCTTGCACGACCTAAACTCGAGTTTAGGTCGTGCAAGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.4-1717s1c1
Sequence:CCGGGGAAACATCTGTAGATCTAAACTCGAGTTTAGATCTACAGATGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177464.4-3673s21c1
Sequence:CCGGCCGTGACAATGATGGATTATTCTCGAGAATAATCCATCATTGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177464.4-1474s21c1
Sequence:CCGGTGCTTCCTCTTTACCCATAAACTCGAGTTTATGGGTAAAGAGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.2-1385s1c1
Sequence:CCGGCCTAAGTGCTTGCTCAGATATCTCGAGATATCTGAGCAAGCACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1827s21c1
Sequence:CCGGCACGTCTTCTACTAGAGTTATCTCGAGATAACTCTAGTAGAAGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1126s21c1
Sequence:CCGGAGCGGTCCTCGTGCATGAAATCTCGAGATTTCATGCACGAGGACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177464
VALIDATED
R3HCC1L MISSION shRNA shRNA Plasmid DNA
R3H domain and coiled-coil containing 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1615s21c1
Sequence:CCGGAGAGGCCTTGCACGACCTAAACTCGAGTTTAGGTCGTGCAAGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.4-1717s1c1
Sequence:CCGGGGAAACATCTGTAGATCTAAACTCGAGTTTAGATCTACAGATGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177464.4-3673s21c1
Sequence:CCGGCCGTGACAATGATGGATTATTCTCGAGAATAATCCATCATTGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177464.4-1474s21c1
Sequence:CCGGTGCTTCCTCTTTACCCATAAACTCGAGTTTATGGGTAAAGAGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.2-1385s1c1
Sequence:CCGGCCTAAGTGCTTGCTCAGATATCTCGAGATATCTGAGCAAGCACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1827s21c1
Sequence:CCGGCACGTCTTCTACTAGAGTTATCTCGAGATAACTCTAGTAGAAGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1126s21c1
Sequence:CCGGAGCGGTCCTCGTGCATGAAATCTCGAGATTTCATGCACGAGGACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177464
VALIDATED
R3HCC1L MISSION shRNA Lentiviral Transduction Particles
R3H domain and coiled-coil containing 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1615s21c1
Sequence:CCGGAGAGGCCTTGCACGACCTAAACTCGAGTTTAGGTCGTGCAAGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.4-1717s1c1
Sequence:CCGGGGAAACATCTGTAGATCTAAACTCGAGTTTAGATCTACAGATGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177464.4-3673s21c1
Sequence:CCGGCCGTGACAATGATGGATTATTCTCGAGAATAATCCATCATTGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177464.4-1474s21c1
Sequence:CCGGTGCTTCCTCTTTACCCATAAACTCGAGTTTATGGGTAAAGAGGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177464.2-1385s1c1
Sequence:CCGGCCTAAGTGCTTGCTCAGATATCTCGAGATATCTGAGCAAGCACTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1827s21c1
Sequence:CCGGCACGTCTTCTACTAGAGTTATCTCGAGATAACTCTAGTAGAAGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177464.4-1126s21c1
Sequence:CCGGAGCGGTCCTCGTGCATGAAATCTCGAGATTTCATGCACGAGGACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014472
R3HCC1L MISSION shRNA Bacterial Glycerol Stock
R3H domain and coiled-coil containing 1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014472.4-3173s21c1
Sequence:CCGGTACAGGAGATGTGGGTATTTACTCGAGTAAATACCCACATCTCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1702s21c1
Sequence:CCGGTGCTTCCTCCTTACCTATAAACTCGAGTTTATAGGTAAGGAGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1899s1c1
Sequence:CCGGGCAAGATGACTCAGGGAGTATCTCGAGATACTCCCTGAGTCATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2097s1c1
Sequence:CCGGGATGCACATAAAGCCCGAGAACTCGAGTTCTCGGGCTTTATGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-581s1c1
Sequence:CCGGGAATGGACACATGCCTTCAAACTCGAGTTTGAAGGCATGTGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-430s1c1
Sequence:CCGGCCTAACTCTGTGGTGAAAGAACTCGAGTTCTTTCACCACAGAGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1120s1c1
Sequence:CCGGCCAGATGGTGTCTTTGATCAACTCGAGTTGATCAAAGACACCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-492s21c1
Sequence:CCGGCGGAGGCTCGAAGACTAAATACTCGAGTATTTAGTCTTCGAGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2406s1c1
Sequence:CCGGCATGGTGAAGATTCGTCCCTTCTCGAGAAGGGACGAATCTTCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2380s1c1
Sequence:CCGGCGTGATGCGTTGGGTATTAAACTCGAGTTTAATACCCAACGCATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1126s21c1
Sequence:CCGGTGATCAAACTTGCGTAGATTTCTCGAGAAATCTACGCAAGTTTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1498s21c1
Sequence:CCGGAGCTGATGAGACCTCTATTAACTCGAGTTAATAGAGGTCTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014472
R3HCC1L MISSION shRNA shRNA Plasmid DNA
R3H domain and coiled-coil containing 1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014472.4-3173s21c1
Sequence:CCGGTACAGGAGATGTGGGTATTTACTCGAGTAAATACCCACATCTCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1702s21c1
Sequence:CCGGTGCTTCCTCCTTACCTATAAACTCGAGTTTATAGGTAAGGAGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1899s1c1
Sequence:CCGGGCAAGATGACTCAGGGAGTATCTCGAGATACTCCCTGAGTCATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2097s1c1
Sequence:CCGGGATGCACATAAAGCCCGAGAACTCGAGTTCTCGGGCTTTATGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-581s1c1
Sequence:CCGGGAATGGACACATGCCTTCAAACTCGAGTTTGAAGGCATGTGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-430s1c1
Sequence:CCGGCCTAACTCTGTGGTGAAAGAACTCGAGTTCTTTCACCACAGAGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1120s1c1
Sequence:CCGGCCAGATGGTGTCTTTGATCAACTCGAGTTGATCAAAGACACCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-492s21c1
Sequence:CCGGCGGAGGCTCGAAGACTAAATACTCGAGTATTTAGTCTTCGAGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2406s1c1
Sequence:CCGGCATGGTGAAGATTCGTCCCTTCTCGAGAAGGGACGAATCTTCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2380s1c1
Sequence:CCGGCGTGATGCGTTGGGTATTAAACTCGAGTTTAATACCCAACGCATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1126s21c1
Sequence:CCGGTGATCAAACTTGCGTAGATTTCTCGAGAAATCTACGCAAGTTTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1498s21c1
Sequence:CCGGAGCTGATGAGACCTCTATTAACTCGAGTTAATAGAGGTCTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014472
R3HCC1L MISSION shRNA Lentiviral Transduction Particles
R3H domain and coiled-coil containing 1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014472.4-3173s21c1
Sequence:CCGGTACAGGAGATGTGGGTATTTACTCGAGTAAATACCCACATCTCCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1702s21c1
Sequence:CCGGTGCTTCCTCCTTACCTATAAACTCGAGTTTATAGGTAAGGAGGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1899s1c1
Sequence:CCGGGCAAGATGACTCAGGGAGTATCTCGAGATACTCCCTGAGTCATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2097s1c1
Sequence:CCGGGATGCACATAAAGCCCGAGAACTCGAGTTCTCGGGCTTTATGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-581s1c1
Sequence:CCGGGAATGGACACATGCCTTCAAACTCGAGTTTGAAGGCATGTGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-430s1c1
Sequence:CCGGCCTAACTCTGTGGTGAAAGAACTCGAGTTCTTTCACCACAGAGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-1120s1c1
Sequence:CCGGCCAGATGGTGTCTTTGATCAACTCGAGTTGATCAAAGACACCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-492s21c1
Sequence:CCGGCGGAGGCTCGAAGACTAAATACTCGAGTATTTAGTCTTCGAGCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2406s1c1
Sequence:CCGGCATGGTGAAGATTCGTCCCTTCTCGAGAAGGGACGAATCTTCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014472.2-2380s1c1
Sequence:CCGGCGTGATGCGTTGGGTATTAAACTCGAGTTTAATACCCAACGCATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1126s21c1
Sequence:CCGGTGATCAAACTTGCGTAGATTTCTCGAGAAATCTACGCAAGTTTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014472.4-1498s21c1
Sequence:CCGGAGCTGATGAGACCTCTATTAACTCGAGTTAATAGAGGTCTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)