EMAIL THIS PAGE TO A FRIEND

R3HDM1

R3H domain containing 1

152 Gene Product Result for
Synonyms: R3HDM
UniProtKB ID: Q15032, Q8IW32
Gene ID:
Mouse(226412) R3H domain containing 1
Rat(304763) R3H domain containing 1
Zebrafish(560062) R3H domain containing 1
chicken(424292) R3H domain containing 1
Horse(100050822) R3H domain containing 1
dog(476129) R3H domain containing 1
cow(533850) R3H domain containing 1
sheep(101104555) R3H domain containing 1
naked mole-rat(101697023) R3H domain containing 1
domestic guinea pig(100735698) R3H domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015361 Rosetta Predictions human pricing
NM_001134867 Rosetta Predictions rat pricing
XM_001054959 Rosetta Predictions rat pricing
XM_001055078 Rosetta Predictions rat pricing
XM_001055206 Rosetta Predictions rat pricing
XM_001055266 Rosetta Predictions rat pricing
NM_181750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347692 predicted 1447
2 SASI_Hs01_00152874 predicted 3592
3 SASI_Hs01_00152875 predicted 2953
4 SASI_Hs01_00152877 predicted 1483
5 SASI_Hs02_00347693 predicted 776
6 SASI_Hs01_00152880 predicted 1607
7 SASI_Hs02_00347694 predicted 3492
8 SASI_Hs01_00152881 predicted 1873
9 SASI_Hs02_00347695 predicted 3711
10 SASI_Hs02_00347696 predicted 3177
11 SASI_Hs01_00152873 predicted 3146
12 SASI_Hs01_00152876 predicted 1117
13 SASI_Hs01_00152878 predicted 1070
14 SASI_Hs01_00152879 predicted 687
15 SASI_Hs01_00152882 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258874 predicted 1141
2 SASI_Rn02_00258875 predicted 847
3 SASI_Rn02_00258876 predicted 3882
4 SASI_Rn02_00258877 predicted 2790
5 SASI_Rn02_00258878 predicted 1060
6 SASI_Rn02_00258879 predicted 1267
7 SASI_Rn02_00258880 predicted 3753
8 SASI_Rn02_00258881 predicted 2726
9 SASI_Rn02_00258882 predicted 579
10 SASI_Rn02_00258883 predicted 2836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277832 predicted 1139
2 SASI_Rn02_00277833 predicted 848
3 SASI_Rn02_00277834 predicted 755
4 SASI_Rn02_00277835 predicted 940
5 SASI_Rn02_00277836 predicted 624
6 SASI_Rn02_00277837 predicted 1061
7 SASI_Rn02_00277838 predicted 822
8 SASI_Rn02_00277839 predicted 870
9 SASI_Rn02_00277840 predicted 1273
10 SASI_Rn02_00277841 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278375 predicted 1149
2 SASI_Rn02_00278376 predicted 848
3 SASI_Rn02_00278377 predicted 3787
4 SASI_Rn02_00278378 predicted 2689
5 SASI_Rn02_00278379 predicted 1055
6 SASI_Rn02_00278380 predicted 1275
7 SASI_Rn02_00278381 predicted 3651
8 SASI_Rn02_00278382 predicted 2623
9 SASI_Rn02_00278383 predicted 583
10 SASI_Rn02_00278384 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278800 predicted 1010
2 SASI_Rn02_00278801 predicted 709
3 SASI_Rn02_00278802 predicted 3758
4 SASI_Rn02_00278803 predicted 2659
5 SASI_Rn02_00278804 predicted 927
6 SASI_Rn02_00278805 predicted 1142
7 SASI_Rn02_00278806 predicted 3621
8 SASI_Rn02_00278807 predicted 2597
9 SASI_Rn02_00278808 predicted 2714
10 SASI_Rn02_00278809 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279036 predicted 1148
2 SASI_Rn02_00279037 predicted 842
3 SASI_Rn02_00279038 predicted 3882
4 SASI_Rn02_00279039 predicted 2792
5 SASI_Rn02_00279040 predicted 1060
6 SASI_Rn02_00279041 predicted 1269
7 SASI_Rn02_00279042 predicted 3754
8 SASI_Rn02_00279043 predicted 2729
9 SASI_Rn02_00279044 predicted 580
10 SASI_Rn02_00279045 predicted 2846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165694 predicted 2614
2 SASI_Mm02_00349912 predicted 2749
3 SASI_Mm01_00165695 predicted 3879
4 SASI_Mm01_00165696 predicted 3342
5 SASI_Mm01_00165697 predicted 2828
6 SASI_Mm01_00165698 predicted 2774
7 SASI_Mm01_00165699 predicted 853
8 SASI_Mm01_00165700 predicted 3136
9 SASI_Mm01_00165701 predicted 570
10 SASI_Mm01_00165702 predicted 2913
11 SASI_Mm01_00165703 predicted 3905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015361
VALIDATED
R3HDM1 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-3485s21c1
Sequence:GTACCGGGCCAACCCTGAACGCTCTAAACTCGAGTTTAGAGCGTTCAGGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1243s21c1
Sequence:CCGGGAGAGCCAGAGACCGAATATTCTCGAGAATATTCGGTCTCTGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1114s21c1
Sequence:CCGGAGACTTTCAGAAACGTTATATCTCGAGATATAACGTTTCTGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1175s21c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-753s21c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015361.2-4302s21c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-754s1c1
Sequence:CCGGCAGTGATAAGTTGCCCAGAAACTCGAGTTTCTGGGCAACTTATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-2503s1c1
Sequence:CCGGCCAACCCAACAGCATTGGAAACTCGAGTTTCCAATGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-753s1c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015361.2-4302s1c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-1175s1c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1027s21c1
Sequence:GTACCGGTGGGAAGTCTGTCATAGTAAACTCGAGTTTACTATGACAGACTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015361
VALIDATED
R3HDM1 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-3485s21c1
Sequence:GTACCGGGCCAACCCTGAACGCTCTAAACTCGAGTTTAGAGCGTTCAGGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1243s21c1
Sequence:CCGGGAGAGCCAGAGACCGAATATTCTCGAGAATATTCGGTCTCTGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1114s21c1
Sequence:CCGGAGACTTTCAGAAACGTTATATCTCGAGATATAACGTTTCTGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1175s21c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-753s21c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015361.2-4302s21c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-754s1c1
Sequence:CCGGCAGTGATAAGTTGCCCAGAAACTCGAGTTTCTGGGCAACTTATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-2503s1c1
Sequence:CCGGCCAACCCAACAGCATTGGAAACTCGAGTTTCCAATGCTGTTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-753s1c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015361.2-4302s1c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-1175s1c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1027s21c1
Sequence:GTACCGGTGGGAAGTCTGTCATAGTAAACTCGAGTTTACTATGACAGACTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015361
VALIDATED
R3HDM1 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-3485s21c1
Sequence:GTACCGGGCCAACCCTGAACGCTCTAAACTCGAGTTTAGAGCGTTCAGGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1243s21c1
Sequence:CCGGGAGAGCCAGAGACCGAATATTCTCGAGAATATTCGGTCTCTGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-1114s21c1
Sequence:CCGGAGACTTTCAGAAACGTTATATCTCGAGATATAACGTTTCTGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1175s21c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015361.2-753s21c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015361.2-4302s21c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-754s1c1
Sequence:CCGGCAGTGATAAGTTGCCCAGAAACTCGAGTTTCTGGGCAACTTATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-2503s1c1
Sequence:CCGGCCAACCCAACAGCATTGGAAACTCGAGTTTCCAATGCTGTTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-753s1c1
Sequence:CCGGCCAGTGATAAGTTGCCCAGAACTCGAGTTCTGGGCAACTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015361.2-4302s1c1
Sequence:CCGGGCCTCTTAAACCACTTACATTCTCGAGAATGTAAGTGGTTTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015361.2-1175s1c1
Sequence:CCGGCAGATGAGAATACGTTTGAAACTCGAGTTTCAAACGTATTCTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015361.2-1027s21c1
Sequence:GTACCGGTGGGAAGTCTGTCATAGTAAACTCGAGTTTACTATGACAGACTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181750
VALIDATED
R3HDM1 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2888s21c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181750.2-3883s21c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1406s21c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1766s21c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2837s21c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1406s1c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1766s1c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-2837s1c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-3883s1c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181750.2-2888s1c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181750
VALIDATED
R3HDM1 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2888s21c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181750.2-3883s21c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1406s21c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1766s21c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2837s21c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1406s1c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1766s1c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-2837s1c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-3883s1c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181750.2-2888s1c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181750
VALIDATED
R3HDM1 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2888s21c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181750.2-3883s21c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1406s21c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-1766s21c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181750.2-2837s21c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1406s1c1
Sequence:CCGGCGCCAGATATTTAGAGTTAATCTCGAGATTAACTCTAAATATCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-1766s1c1
Sequence:CCGGGCCAGCAATCACAGTTCTCTTCTCGAGAAGAGAACTGTGATTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-2837s1c1
Sequence:CCGGCCAGTCTATTACAGTGTCATTCTCGAGAATGACACTGTAATAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181750.2-3883s1c1
Sequence:CCGGCCCATCTGATTGGCTTGTTAACTCGAGTTAACAAGCCAATCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181750.2-2888s1c1
Sequence:CCGGGCAGTTGGTTACTTACAACATCTCGAGATGTTGTAAGTAACCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)