EMAIL THIS PAGE TO A FRIEND

R3HDM2

R3H domain containing 2

69 Gene Product Result for
Synonyms: PR01365
UniProtKB ID: Q9Y2K5, Q2M1T9, Q3ZCT5
Gene ID:
Mouse(71750) R3H domain containing 2
Rat(362894) R3H domain containing 2
domestic guinea pig(100723954) R3H domain containing 2
naked mole-rat(101718968) R3H domain containing 2
Domestic Rabbit(100357871) R3H domain containing 2
cow(613499) R3H domain containing 2
sheep(101122095) R3H domain containing 2
Zebrafish(100330669) R3H domain containing 2
chicken(426509) R3H domain containing 2
Horse(100053125) R3H domain containing 2
domestic cat(101091954) R3H domain containing 2
dog(474412) R3H domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014925 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014925 Rosetta Predictions human pricing
NM_001130557 Rosetta Predictions rat pricing
NM_027900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346573 predicted 489
2 SASI_Hs02_00346574 predicted 777
3 SASI_Hs02_00346575 predicted 556
4 SASI_Hs02_00346576 predicted 433
5 SASI_Hs02_00346577 predicted 479
6 SASI_Hs02_00346578 predicted 490
7 SASI_Hs02_00346579 predicted 1614
8 SASI_Hs02_00346580 predicted 815
9 SASI_Hs02_00346581 predicted 623
10 SASI_Hs02_00346582 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255739 predicted 3148
2 SASI_Rn02_00255740 predicted 640
3 SASI_Rn02_00255741 predicted 378
4 SASI_Rn02_00255742 predicted 1601
5 SASI_Rn02_00255743 predicted 1715
6 SASI_Rn02_00255744 predicted 938
7 SASI_Rn02_00255745 predicted 397
8 SASI_Rn02_00255746 predicted 2377
9 SASI_Rn02_00255747 predicted 2089
10 SASI_Rn02_00255748 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066568 predicted 1152
2 SASI_Mm02_00332871 predicted 1063
3 SASI_Mm02_00332872 predicted 1310
4 SASI_Mm01_00066569 predicted 811
5 SASI_Mm01_00066570 predicted 3244
6 SASI_Mm01_00066571 predicted 2171
7 SASI_Mm01_00066572 predicted 1278
8 SASI_Mm01_00066574 predicted 2543
9 SASI_Mm01_00066576 predicted 1131
10 SASI_Mm02_00332873 predicted 2178
11 SASI_Mm01_00066573 predicted 831
12 SASI_Mm01_00066575 predicted 3476
13 SASI_Mm01_00066577 predicted 1325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027900
VALIDATED
R3HDM2 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1338s21c1
Sequence:CCGGATAACCAGACCGGCCAGAATGCTCGAGCATTCTGGCCGGTCTGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027900.4-3834s21c1
Sequence:CCGGATTTCATCACCAGCCCAATCTCTCGAGAGATTGGGCTGGTGATGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1245s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-595s21c1
Sequence:CCGGACTGGTGGAAGAATCTGTAAACTCGAGTTTACAGATTCTTCCACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3470s1c1
Sequence:CCGGGCTTCAAACTCCGAGTGGATACTCGAGTATCCACTCGGAGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-2184s1c1
Sequence:CCGGCCTAATTCCAACCAGCAATATCTCGAGATATTGCTGGTTGGAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1137s1c1
Sequence:CCGGCGGATGCTATTACATCGGGTACTCGAGTACCCGATGTAATAGCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1814s1c1
Sequence:CCGGGCCACCCTTGAATAATCACATCTCGAGATGTGATTATTCAAGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3728s1c1
Sequence:CCGGCCTTCCCATCTTCTATCATTTCTCGAGAAATGATAGAAGATGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027900
VALIDATED
R3HDM2 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1338s21c1
Sequence:CCGGATAACCAGACCGGCCAGAATGCTCGAGCATTCTGGCCGGTCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027900.4-3834s21c1
Sequence:CCGGATTTCATCACCAGCCCAATCTCTCGAGAGATTGGGCTGGTGATGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1245s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-595s21c1
Sequence:CCGGACTGGTGGAAGAATCTGTAAACTCGAGTTTACAGATTCTTCCACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3470s1c1
Sequence:CCGGGCTTCAAACTCCGAGTGGATACTCGAGTATCCACTCGGAGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-2184s1c1
Sequence:CCGGCCTAATTCCAACCAGCAATATCTCGAGATATTGCTGGTTGGAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1137s1c1
Sequence:CCGGCGGATGCTATTACATCGGGTACTCGAGTACCCGATGTAATAGCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1814s1c1
Sequence:CCGGGCCACCCTTGAATAATCACATCTCGAGATGTGATTATTCAAGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3728s1c1
Sequence:CCGGCCTTCCCATCTTCTATCATTTCTCGAGAAATGATAGAAGATGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027900
VALIDATED
R3HDM2 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1338s21c1
Sequence:CCGGATAACCAGACCGGCCAGAATGCTCGAGCATTCTGGCCGGTCTGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027900.4-3834s21c1
Sequence:CCGGATTTCATCACCAGCCCAATCTCTCGAGAGATTGGGCTGGTGATGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-1245s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027900.4-595s21c1
Sequence:CCGGACTGGTGGAAGAATCTGTAAACTCGAGTTTACAGATTCTTCCACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3470s1c1
Sequence:CCGGGCTTCAAACTCCGAGTGGATACTCGAGTATCCACTCGGAGTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-2184s1c1
Sequence:CCGGCCTAATTCCAACCAGCAATATCTCGAGATATTGCTGGTTGGAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1137s1c1
Sequence:CCGGCGGATGCTATTACATCGGGTACTCGAGTACCCGATGTAATAGCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-1814s1c1
Sequence:CCGGGCCACCCTTGAATAATCACATCTCGAGATGTGATTATTCAAGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027900.2-3728s1c1
Sequence:CCGGCCTTCCCATCTTCTATCATTTCTCGAGAAATGATAGAAGATGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014925
VALIDATED
R3HDM2 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-821s21c1
Sequence:GTACCGGCAGTATGGACCGAGATGATAACTCGAGTTATCATCTCGGTCCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-627s21c1
Sequence:CCGGTCATATCACCGGATGCTATTACTCGAGTAATAGCATCCGGTGATATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-2947s21c1
Sequence:CCGGAGCGAGCCAGCTCCCAATAAACTCGAGTTTATTGGGAGCTGGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014925.3-3057s21c1
Sequence:CCGGAGTAAGGAAACTGATGTTAAACTCGAGTTTAACATCAGTTTCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-848s21c1
Sequence:CCGGTGGCCAGAACGGATATCTAAACTCGAGTTTAGATATCCGTTCTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-745s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-3653s1c1
Sequence:CCGGCCGCAGTAACAGACACAGTATCTCGAGATACTGTGTCTGTTACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2405s1c1
Sequence:CCGGGCAAGAGACAAGCACTCAAATCTCGAGATTTGAGTGCTTGTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2043s1c1
Sequence:CCGGCCAGTGGAGTCATTGTAAATACTCGAGTATTTACAATGACTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1281s1c1
Sequence:CCGGCCCTCAGCAGACTAGCTTCATCTCGAGATGAAGCTAGTCTGCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1573s1c1
Sequence:CCGGGCGGCTTACCAAGGCATGATTCTCGAGAATCATGCCTTGGTAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014925
VALIDATED
R3HDM2 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-821s21c1
Sequence:GTACCGGCAGTATGGACCGAGATGATAACTCGAGTTATCATCTCGGTCCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-627s21c1
Sequence:CCGGTCATATCACCGGATGCTATTACTCGAGTAATAGCATCCGGTGATATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-2947s21c1
Sequence:CCGGAGCGAGCCAGCTCCCAATAAACTCGAGTTTATTGGGAGCTGGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014925.3-3057s21c1
Sequence:CCGGAGTAAGGAAACTGATGTTAAACTCGAGTTTAACATCAGTTTCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-848s21c1
Sequence:CCGGTGGCCAGAACGGATATCTAAACTCGAGTTTAGATATCCGTTCTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-745s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-3653s1c1
Sequence:CCGGCCGCAGTAACAGACACAGTATCTCGAGATACTGTGTCTGTTACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2405s1c1
Sequence:CCGGGCAAGAGACAAGCACTCAAATCTCGAGATTTGAGTGCTTGTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2043s1c1
Sequence:CCGGCCAGTGGAGTCATTGTAAATACTCGAGTATTTACAATGACTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1281s1c1
Sequence:CCGGCCCTCAGCAGACTAGCTTCATCTCGAGATGAAGCTAGTCTGCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1573s1c1
Sequence:CCGGGCGGCTTACCAAGGCATGATTCTCGAGAATCATGCCTTGGTAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014925
VALIDATED
R3HDM2 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-821s21c1
Sequence:GTACCGGCAGTATGGACCGAGATGATAACTCGAGTTATCATCTCGGTCCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-627s21c1
Sequence:CCGGTCATATCACCGGATGCTATTACTCGAGTAATAGCATCCGGTGATATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-2947s21c1
Sequence:CCGGAGCGAGCCAGCTCCCAATAAACTCGAGTTTATTGGGAGCTGGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014925.3-3057s21c1
Sequence:CCGGAGTAAGGAAACTGATGTTAAACTCGAGTTTAACATCAGTTTCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014925.3-848s21c1
Sequence:CCGGTGGCCAGAACGGATATCTAAACTCGAGTTTAGATATCCGTTCTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014925.3-745s21c1
Sequence:CCGGAGAGGTTCTCAGAACATATAACTCGAGTTATATGTTCTGAGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-3653s1c1
Sequence:CCGGCCGCAGTAACAGACACAGTATCTCGAGATACTGTGTCTGTTACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2405s1c1
Sequence:CCGGGCAAGAGACAAGCACTCAAATCTCGAGATTTGAGTGCTTGTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-2043s1c1
Sequence:CCGGCCAGTGGAGTCATTGTAAATACTCGAGTATTTACAATGACTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1281s1c1
Sequence:CCGGCCCTCAGCAGACTAGCTTCATCTCGAGATGAAGCTAGTCTGCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014925.2-1573s1c1
Sequence:CCGGGCGGCTTACCAAGGCATGATTCTCGAGAATCATGCCTTGGTAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)