EMAIL THIS PAGE TO A FRIEND

R3HDM4

R3H domain containing 4

62 Gene Product Result for
Synonyms: C19orf22
UniProtKB ID: Q96D70
Gene ID:
Mouse(109284) R3H domain containing 4
Rat(362840) R3H domain containing 4
Zebrafish(791165) R3H domain containing 4
chicken(770563) chromosome 28 open reading frame, human C19orf22
dog(612376) R3H domain containing 4
domestic cat(101093996) R3H domain containing 4
cow(614948) R3H domain containing 4
sheep(101111366) R3H domain containing 4
naked mole-rat(101714033) R3H domain containing 4
domestic guinea pig(100725240) R3H domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138774 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138774 Rosetta Predictions human pricing
XM_001077056 Rosetta Predictions rat pricing
XM_343168 Rosetta Predictions rat pricing
NM_177994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200837 predicted 898
2 SASI_Hs01_00200838 predicted 659
3 SASI_Hs01_00200842 predicted 882
4 SASI_Hs01_00200843 predicted 767
5 SASI_Hs01_00200844 predicted 374
6 SASI_Hs01_00200845 predicted 725
7 SASI_Hs02_00363891 predicted 382
8 SASI_Hs02_00363892 predicted 780
9 SASI_Hs02_00363893 predicted 876
10 SASI_Hs02_00363894 predicted 626
11 SASI_Hs01_00200839 predicted 724
12 SASI_Hs01_00200840 predicted 398
13 SASI_Hs01_00200841 predicted 1003
14 SASI_Hs01_00200846 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355589 predicted 1155
2 SASI_Rn02_00355590 predicted 1146
3 SASI_Rn02_00355591 predicted 1288
4 SASI_Rn02_00355592 predicted 497
5 SASI_Rn02_00355593 predicted 1393
6 SASI_Rn02_00355594 predicted 1293
7 SASI_Rn02_00355595 predicted 628
8 SASI_Rn02_00355596 predicted 412
9 SASI_Rn02_00355597 predicted 526
10 SASI_Rn02_00355598 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395403 predicted 1120
2 SASI_Rn02_00395404 predicted 1151
3 SASI_Rn02_00395405 predicted 627
4 SASI_Rn02_00395406 predicted 511
5 SASI_Rn02_00395407 predicted 1289
6 SASI_Rn02_00395408 predicted 1389
7 SASI_Rn02_00395409 predicted 574
8 SASI_Rn02_00395410 predicted 933
9 SASI_Rn02_00395411 predicted 1215
10 SASI_Rn02_00395412 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348457 predicted 700
2 SASI_Mm02_00348458 predicted 994
3 SASI_Mm02_00348459 predicted 865
4 SASI_Mm02_00348460 predicted 811
5 SASI_Mm02_00348461 predicted 374
6 SASI_Mm02_00348462 predicted 1129
7 SASI_Mm02_00348463 predicted 863
8 SASI_Mm02_00348464 predicted 655
9 SASI_Mm02_00348465 predicted 365
10 SASI_Mm02_00348466 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177994
R3HDM4 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-243s21c1
Sequence:CCGGGTCTGCAGCGTTTGGAGAATACTCGAGTATTCTCCAAACGCTGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-166s21c1
Sequence:CCGGGTCCAGACGCAAGCAGCATTTCTCGAGAAATGCTGCTTGCGTCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-647s21c1
Sequence:CCGGCAAGCTGTGTACACCGCTATGCTCGAGCATAGCGGTGTACACAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-379s21c1
Sequence:CCGGTGTGGAGGTCTGGAATGATTTCTCGAGAAATCATTCCAGACCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-743s1c1
Sequence:CCGGGAGGCAGATGAAAGTCAGCAACTCGAGTTGCTGACTTTCATCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-651s1c1
Sequence:CCGGGCTATGCTGGACAACAGCTATCTCGAGATAGCTGTTGTCCAGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-239s1c1
Sequence:CCGGGCGTTTGGAGAATACCCAGTACTCGAGTACTGGGTATTCTCCAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177994.4-1045s21c1
Sequence:CCGGGTCCACCCTGGTACTTGTATTCTCGAGAATACAAGTACCAGGGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177994
R3HDM4 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-243s21c1
Sequence:CCGGGTCTGCAGCGTTTGGAGAATACTCGAGTATTCTCCAAACGCTGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-166s21c1
Sequence:CCGGGTCCAGACGCAAGCAGCATTTCTCGAGAAATGCTGCTTGCGTCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-647s21c1
Sequence:CCGGCAAGCTGTGTACACCGCTATGCTCGAGCATAGCGGTGTACACAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-379s21c1
Sequence:CCGGTGTGGAGGTCTGGAATGATTTCTCGAGAAATCATTCCAGACCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-743s1c1
Sequence:CCGGGAGGCAGATGAAAGTCAGCAACTCGAGTTGCTGACTTTCATCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-651s1c1
Sequence:CCGGGCTATGCTGGACAACAGCTATCTCGAGATAGCTGTTGTCCAGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-239s1c1
Sequence:CCGGGCGTTTGGAGAATACCCAGTACTCGAGTACTGGGTATTCTCCAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177994.4-1045s21c1
Sequence:CCGGGTCCACCCTGGTACTTGTATTCTCGAGAATACAAGTACCAGGGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177994
R3HDM4 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-243s21c1
Sequence:CCGGGTCTGCAGCGTTTGGAGAATACTCGAGTATTCTCCAAACGCTGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-166s21c1
Sequence:CCGGGTCCAGACGCAAGCAGCATTTCTCGAGAAATGCTGCTTGCGTCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-647s21c1
Sequence:CCGGCAAGCTGTGTACACCGCTATGCTCGAGCATAGCGGTGTACACAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177994.4-379s21c1
Sequence:CCGGTGTGGAGGTCTGGAATGATTTCTCGAGAAATCATTCCAGACCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-743s1c1
Sequence:CCGGGAGGCAGATGAAAGTCAGCAACTCGAGTTGCTGACTTTCATCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-651s1c1
Sequence:CCGGGCTATGCTGGACAACAGCTATCTCGAGATAGCTGTTGTCCAGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177994.2-239s1c1
Sequence:CCGGGCGTTTGGAGAATACCCAGTACTCGAGTACTGGGTATTCTCCAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177994.4-1045s21c1
Sequence:CCGGGTCCACCCTGGTACTTGTATTCTCGAGAATACAAGTACCAGGGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138774
R3HDM4 MISSION shRNA Bacterial Glycerol Stock
R3H domain containing 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-781s1c1
Sequence:CCGGCAGTAATCGGCACCTGGATTTCTCGAGAAATCCAGGTGCCGATTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-178s1c1
Sequence:CCGGGCGGAAACAGCACTTCATCAACTCGAGTTGATGAAGTGCTGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138774.2-898s21c1
Sequence:CCGGCCTCCGATACCTTCGGCTAAACTCGAGTTTAGCCGAAGGTATCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-767s21c1
Sequence:CCGGCGGCAGATGAAGGTCAGTAATCTCGAGATTACTGACCTTCATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-388s21c1
Sequence:CCGGTGTGGAGGTCTGGAACGATTTCTCGAGAAATCGTTCCAGACCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-342s21c1
Sequence:CCGGCTGCATCACCAGGCATCTTTGCTCGAGCAAAGATGCCTGGTGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-663s21c1
Sequence:CCGGCCGTGTACACAGCAATGCTAGCTCGAGCTAGCATTGCTGTGTACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138774
R3HDM4 MISSION shRNA shRNA Plasmid DNA
R3H domain containing 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-781s1c1
Sequence:CCGGCAGTAATCGGCACCTGGATTTCTCGAGAAATCCAGGTGCCGATTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-178s1c1
Sequence:CCGGGCGGAAACAGCACTTCATCAACTCGAGTTGATGAAGTGCTGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138774.2-898s21c1
Sequence:CCGGCCTCCGATACCTTCGGCTAAACTCGAGTTTAGCCGAAGGTATCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-767s21c1
Sequence:CCGGCGGCAGATGAAGGTCAGTAATCTCGAGATTACTGACCTTCATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-388s21c1
Sequence:CCGGTGTGGAGGTCTGGAACGATTTCTCGAGAAATCGTTCCAGACCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-342s21c1
Sequence:CCGGCTGCATCACCAGGCATCTTTGCTCGAGCAAAGATGCCTGGTGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-663s21c1
Sequence:CCGGCCGTGTACACAGCAATGCTAGCTCGAGCTAGCATTGCTGTGTACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138774
R3HDM4 MISSION shRNA Lentiviral Transduction Particles
R3H domain containing 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-781s1c1
Sequence:CCGGCAGTAATCGGCACCTGGATTTCTCGAGAAATCCAGGTGCCGATTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138774.2-178s1c1
Sequence:CCGGGCGGAAACAGCACTTCATCAACTCGAGTTGATGAAGTGCTGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138774.2-898s21c1
Sequence:CCGGCCTCCGATACCTTCGGCTAAACTCGAGTTTAGCCGAAGGTATCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-767s21c1
Sequence:CCGGCGGCAGATGAAGGTCAGTAATCTCGAGATTACTGACCTTCATCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-388s21c1
Sequence:CCGGTGTGGAGGTCTGGAACGATTTCTCGAGAAATCGTTCCAGACCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-342s21c1
Sequence:CCGGCTGCATCACCAGGCATCTTTGCTCGAGCAAAGATGCCTGGTGATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138774.2-663s21c1
Sequence:CCGGCCGTGTACACAGCAATGCTAGCTCGAGCTAGCATTGCTGTGTACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)