EMAIL THIS PAGE TO A FRIEND

R3HDML

R3H domain containing-like

43 Gene Product Result for
Synonyms: dJ881L22.3
UniProtKB ID: Q9H3Y0
Gene ID:
Mouse(100043899) R3H domain containing-like
Rat(366245) R3H domain containing-like
domestic guinea pig(100720334) R3H domain containing-like
naked mole-rat(101710732) R3H domain containing-like
cow(533734) R3H domain containing-like
sheep(101106099) R3H domain containing-like
Zebrafish(561976) R3H domain containing-like
domestic cat(101093263) R3H domain containing-like
dog(485883) R3H domain containing-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA070264 Anti-R3HDML antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178491 Rosetta Predictions human pricing
NM_001108962 Rosetta Predictions rat pricing
NM_001099331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369727 predicted 491
2 SASI_Hs01_00129656 predicted 332
3 SASI_Hs01_00129658 predicted 669
4 SASI_Hs01_00129660 predicted 351
5 SASI_Hs01_00129661 predicted 870
6 SASI_Hs01_00129662 predicted 587
7 SASI_Hs01_00129663 predicted 777
8 SASI_Hs01_00129664 predicted 380
9 SASI_Hs02_00369728 predicted 789
10 SASI_Hs02_00369729 predicted 999
11 SASI_Hs01_00129657 predicted 1020
12 SASI_Hs01_00129659 predicted 724
13 SASI_Hs01_00129665 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243804 predicted 588
2 SASI_Rn02_00243805 predicted 509
3 SASI_Rn02_00243806 predicted 654
4 SASI_Rn02_00243807 predicted 519
5 SASI_Rn02_00243808 predicted 235
6 SASI_Rn02_00243809 predicted 548
7 SASI_Rn02_00243810 predicted 331
8 SASI_Rn02_00243811 predicted 416
9 SASI_Rn02_00243812 predicted 362
10 SASI_Rn02_00243813 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301787 predicted 520
2 SASI_Mm02_00301788 predicted 488
3 SASI_Mm02_00301789 predicted 409
4 SASI_Mm02_00301790 predicted 565
5 SASI_Mm02_00301791 predicted 361
6 SASI_Mm02_00301792 predicted 524
7 SASI_Mm02_00301793 predicted 357
8 SASI_Mm02_00301794 predicted 333
9 SASI_Mm02_00301795 predicted 415
10 SASI_Mm02_00301796 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178491
R3HDML MISSION shRNA Bacterial Glycerol Stock
R3H domain containing-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-355s1c1
Sequence:CCGGCAGAACCTCTCCATCCATTCTCTCGAGAGAATGGATGGAGAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-67s1c1
Sequence:CCGGGCCTTGATAATGCCTAATGCTCTCGAGAGCATTAGGCATTATCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-327s1c1
Sequence:CCGGGCCTTCACAGCTGATGAGATACTCGAGTATCTCATCAGCTGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-607s1c1
Sequence:CCGGCTGGTCTGCAACTATGCCATTCTCGAGAATGGCATAGTTGCAGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-601s1c1
Sequence:CCGGGCATACCTGGTCTGCAACTATCTCGAGATAGTTGCAGACCAGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-414s1c1
Sequence:CCGGGTCTGAGGAGAAGTGGCATTACTCGAGTAATGCCACTTCTCCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-178s1c1
Sequence:CCGGGTGAGAGACATGAATGCCTTACTCGAGTAAGGCATTCATGTCTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-63s1c1
Sequence:CCGGGAACGCCTTGATAATGCCTAACTCGAGTTAGGCATTATCAAGGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-397s1c1
Sequence:CCGGGATCTCATGAAGTCCTGGTCTCTCGAGAGACCAGGACTTCATGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178491
R3HDML MISSION shRNA shRNA Plasmid DNA
R3H domain containing-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-355s1c1
Sequence:CCGGCAGAACCTCTCCATCCATTCTCTCGAGAGAATGGATGGAGAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-67s1c1
Sequence:CCGGGCCTTGATAATGCCTAATGCTCTCGAGAGCATTAGGCATTATCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-327s1c1
Sequence:CCGGGCCTTCACAGCTGATGAGATACTCGAGTATCTCATCAGCTGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-607s1c1
Sequence:CCGGCTGGTCTGCAACTATGCCATTCTCGAGAATGGCATAGTTGCAGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-601s1c1
Sequence:CCGGGCATACCTGGTCTGCAACTATCTCGAGATAGTTGCAGACCAGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-414s1c1
Sequence:CCGGGTCTGAGGAGAAGTGGCATTACTCGAGTAATGCCACTTCTCCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-178s1c1
Sequence:CCGGGTGAGAGACATGAATGCCTTACTCGAGTAAGGCATTCATGTCTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-63s1c1
Sequence:CCGGGAACGCCTTGATAATGCCTAACTCGAGTTAGGCATTATCAAGGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-397s1c1
Sequence:CCGGGATCTCATGAAGTCCTGGTCTCTCGAGAGACCAGGACTTCATGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178491
R3HDML MISSION shRNA Lentiviral Transduction Particles
R3H domain containing-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-355s1c1
Sequence:CCGGCAGAACCTCTCCATCCATTCTCTCGAGAGAATGGATGGAGAGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-67s1c1
Sequence:CCGGGCCTTGATAATGCCTAATGCTCTCGAGAGCATTAGGCATTATCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-327s1c1
Sequence:CCGGGCCTTCACAGCTGATGAGATACTCGAGTATCTCATCAGCTGTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-607s1c1
Sequence:CCGGCTGGTCTGCAACTATGCCATTCTCGAGAATGGCATAGTTGCAGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-601s1c1
Sequence:CCGGGCATACCTGGTCTGCAACTATCTCGAGATAGTTGCAGACCAGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-414s1c1
Sequence:CCGGGTCTGAGGAGAAGTGGCATTACTCGAGTAATGCCACTTCTCCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-178s1c1
Sequence:CCGGGTGAGAGACATGAATGCCTTACTCGAGTAAGGCATTCATGTCTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-63s1c1
Sequence:CCGGGAACGCCTTGATAATGCCTAACTCGAGTTAGGCATTATCAAGGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178491.1-397s1c1
Sequence:CCGGGATCTCATGAAGTCCTGGTCTCTCGAGAGACCAGGACTTCATGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099331
R3HDML MISSION shRNA Bacterial Glycerol Stock
R3H domain containing-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-595s21c1
Sequence:CCGGGAGAAGCGCCATTACTCATTCCTCGAGGAATGAGTAATGGCGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-663s21c1
Sequence:CCGGTCCTGTCTGCTCCCACTATACCTCGAGGTATAGTGGGAGCAGACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-362s21c1
Sequence:CCGGTGAGCGCTTTACTGGATTATCCTCGAGGATAATCCAGTAAAGCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-415s21c1
Sequence:CCGGGCTGCCAACATGGAGTATATGCTCGAGCATATACTCCATGTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-528s21c1
Sequence:CCGGCCAGAACCTCTCTATCCATTCCTCGAGGAATGGATAGAGAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099331
R3HDML MISSION shRNA shRNA Plasmid DNA
R3H domain containing-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-595s21c1
Sequence:CCGGGAGAAGCGCCATTACTCATTCCTCGAGGAATGAGTAATGGCGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-663s21c1
Sequence:CCGGTCCTGTCTGCTCCCACTATACCTCGAGGTATAGTGGGAGCAGACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-362s21c1
Sequence:CCGGTGAGCGCTTTACTGGATTATCCTCGAGGATAATCCAGTAAAGCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-415s21c1
Sequence:CCGGGCTGCCAACATGGAGTATATGCTCGAGCATATACTCCATGTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-528s21c1
Sequence:CCGGCCAGAACCTCTCTATCCATTCCTCGAGGAATGGATAGAGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099331
R3HDML MISSION shRNA Lentiviral Transduction Particles
R3H domain containing-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-595s21c1
Sequence:CCGGGAGAAGCGCCATTACTCATTCCTCGAGGAATGAGTAATGGCGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-663s21c1
Sequence:CCGGTCCTGTCTGCTCCCACTATACCTCGAGGTATAGTGGGAGCAGACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-362s21c1
Sequence:CCGGTGAGCGCTTTACTGGATTATCCTCGAGGATAATCCAGTAAAGCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-415s21c1
Sequence:CCGGGCTGCCAACATGGAGTATATGCTCGAGCATATACTCCATGTTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099331.1-528s21c1
Sequence:CCGGCCAGAACCTCTCTATCCATTCCTCGAGGAATGGATAGAGAGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)