EMAIL THIS PAGE TO A FRIEND

RAB11A

RAB11A, member RAS oncogene family

174 Gene Product Result for
Synonyms: YL8
UniProtKB ID: P62491, B2R4B6, B4DT13, P24410, Q5TZN9, Q9JLX1
Gene ID:
Human(8766) Summary: The protein encoded by this gene belongs to the Rab family of the small GTPase superfamily. It is associated with both constitutive and regulated secretory pathways, and may be involved in protein transport. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(53869) RAB11a, member RAS oncogene family
Rat(81830) RAB11a, member RAS oncogene family
Zebrafish(492487) RAB11a, member RAS oncogene family
chicken(415544) RAB11A, member RAS oncogene family
domestic cat(101082410) RAB11A, member RAS oncogene family
dog(403957) RAB11A, member RAS oncogene family
cow(534708) RAB11A, member RAS oncogene family
naked mole-rat(101718831) RAB11A, member RAS oncogene family
Domestic Rabbit(100009072) RAB11A, member RAS oncogene family
domestic guinea pig(100713435) RAB11A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R5903 Anti-Rab11 antibody produced in rabbit 1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB4301708 Anti-RAB11A affinity isolated antibody rat, human, mouse
immunohistochemistry pricing
SAB1104943 Anti-RAB11A (182-195) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1406719 Anti-RAB11A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA051697 Anti-RAB11A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA060686 Anti-RAB11A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2702483 Anti-Rab11a+Rab11bb antibody produced in rabbit affinity isolated antibody zebrafish
pricing
SAB2500848 Anti-RAB11A/YL8 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rabbit, rat, monkey, canine
ELISA, western blot pricing
WH0008766M1 Monoclonal Anti-RAB11A antibody produced in mouse clone 1F7-2A8, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1404620 Monoclonal Anti-RAB11A antibody produced in mouse clone S1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0243 AQUA Peptide STIGVEFAT[R] Drosophila melanogaster, African clawed frog, bakers yeast, chicken, cow, dog, honey bee, human, mouse, rat, soybean, wheat pricing
AQ0242 AQUA Peptide HLTYENVE[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004663 Rosetta Predictions human pricing
NM_031152 Rosetta Predictions rat pricing
NM_017382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126206 predicted 761
2 SASI_Hs01_00126207 predicted 217
3 SASI_Hs01_00126208 predicted 453
4 SASI_Hs01_00126209 predicted 341
5 SASI_Hs01_00126210 predicted 635
6 SASI_Hs01_00126211 predicted 496
7 SASI_Hs01_00126212 predicted 209
8 SASI_Hs01_00126213 predicted 682
9 SASI_Hs02_00338082 predicted 634
10 SASI_Hs02_00338083 predicted 814
11 SASI_Hs01_00126204 predicted 805
12 SASI_Hs01_00126205 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109584 predicted 336
2 SASI_Rn01_00109585 predicted 637
3 SASI_Rn01_00109586 predicted 427
4 SASI_Rn01_00109587 predicted 513
5 SASI_Rn01_00109588 predicted 386
6 SASI_Rn01_00109589 predicted 322
7 SASI_Rn01_00109590 predicted 567
8 SASI_Rn01_00109591 predicted 734
9 SASI_Rn01_00109592 predicted 744
10 SASI_Rn02_00264494 predicted 621
11 SASI_Rn01_00109593 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108290 predicted 769
2 SASI_Mm01_00108291 predicted 225
3 SASI_Mm01_00108292 predicted 501
4 SASI_Mm01_00108294 predicted 456
5 SASI_Mm02_00323875 predicted 392
6 SASI_Mm02_00323876 predicted 215
7 SASI_Mm01_00108296 predicted 808
8 SASI_Mm01_00108297 predicted 690
9 SASI_Mm01_00108298 predicted 700
10 SASI_Mm01_00108299 predicted 386
11 SASI_Mm01_00108293 predicted 589
12 SASI_Mm01_00108295 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004663
VALIDATED
RAB11A MISSION shRNA Bacterial Glycerol Stock
RAB11A, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-167s21c1
Sequence:GTACCGGAGTTGTCCTTATTGGAGATTCCTCGAGGAATCTCCAATAAGGACAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-387s21c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-460s21c1
Sequence:CCGGATCATGCTGATAGTAACATTGCTCGAGCAATGTTACTATCAGCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-349s21c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004663.3-1100s21c1
Sequence:CCGGACCTATTGGTCTTGATCAAATCTCGAGATTTGATCAAGACCAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-566s21c1
Sequence:GTACCGGTGGTTTGTCATTCATTGAAACCTCGAGGTTTCAATGAATGACAAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-482s21c1
Sequence:GTACCGGTATCATGCTTGTGGGCAATAACTCGAGTTATTGCCCACAAGCATGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004663.3-1228s1c1
Sequence:CCGGCCCTATAAACATAGCAGGATTCTCGAGAATCCTGCTATGTTTATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-387s1c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004663.3-348s1c1
Sequence:CCGGCGAGCTATAACATCAGCATATCTCGAGATATGCTGATGTTATAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-209s1c1
Sequence:CCGGCCTGTCTCGATTTACTCGAAACTCGAGTTTCGAGTAAATCGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-349s1c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-702s21c1
Sequence:GTACCGGAGCAACAATGTGGTTCCTATTCTCGAGAATAGGAACCACATTGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004663.3-588s21c1
Sequence:CCGGTCGGCCCTAGACTCTACAAATCTCGAGATTTGTAGAGTCTAGGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004663
VALIDATED
RAB11A MISSION shRNA shRNA Plasmid DNA
RAB11A, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-167s21c1
Sequence:GTACCGGAGTTGTCCTTATTGGAGATTCCTCGAGGAATCTCCAATAAGGACAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-387s21c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-460s21c1
Sequence:CCGGATCATGCTGATAGTAACATTGCTCGAGCAATGTTACTATCAGCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-349s21c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004663.3-1100s21c1
Sequence:CCGGACCTATTGGTCTTGATCAAATCTCGAGATTTGATCAAGACCAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-566s21c1
Sequence:GTACCGGTGGTTTGTCATTCATTGAAACCTCGAGGTTTCAATGAATGACAAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-482s21c1
Sequence:GTACCGGTATCATGCTTGTGGGCAATAACTCGAGTTATTGCCCACAAGCATGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004663.3-1228s1c1
Sequence:CCGGCCCTATAAACATAGCAGGATTCTCGAGAATCCTGCTATGTTTATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-387s1c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004663.3-348s1c1
Sequence:CCGGCGAGCTATAACATCAGCATATCTCGAGATATGCTGATGTTATAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-209s1c1
Sequence:CCGGCCTGTCTCGATTTACTCGAAACTCGAGTTTCGAGTAAATCGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-349s1c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-702s21c1
Sequence:GTACCGGAGCAACAATGTGGTTCCTATTCTCGAGAATAGGAACCACATTGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004663.3-588s21c1
Sequence:CCGGTCGGCCCTAGACTCTACAAATCTCGAGATTTGTAGAGTCTAGGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004663
VALIDATED
RAB11A MISSION shRNA Lentiviral Transduction Particles
RAB11A, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-167s21c1
Sequence:GTACCGGAGTTGTCCTTATTGGAGATTCCTCGAGGAATCTCCAATAAGGACAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-387s21c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-460s21c1
Sequence:CCGGATCATGCTGATAGTAACATTGCTCGAGCAATGTTACTATCAGCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-349s21c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004663.3-1100s21c1
Sequence:CCGGACCTATTGGTCTTGATCAAATCTCGAGATTTGATCAAGACCAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-566s21c1
Sequence:GTACCGGTGGTTTGTCATTCATTGAAACCTCGAGGTTTCAATGAATGACAAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-482s21c1
Sequence:GTACCGGTATCATGCTTGTGGGCAATAACTCGAGTTATTGCCCACAAGCATGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004663.3-1228s1c1
Sequence:CCGGCCCTATAAACATAGCAGGATTCTCGAGAATCCTGCTATGTTTATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-387s1c1
Sequence:CCGGGCCTTATTGGTTTATGACATTCTCGAGAATGTCATAAACCAATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004663.3-348s1c1
Sequence:CCGGCGAGCTATAACATCAGCATATCTCGAGATATGCTGATGTTATAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-209s1c1
Sequence:CCGGCCTGTCTCGATTTACTCGAAACTCGAGTTTCGAGTAAATCGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004663.3-349s1c1
Sequence:CCGGGAGCTATAACATCAGCATATTCTCGAGAATATGCTGATGTTATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004663.3-702s21c1
Sequence:GTACCGGAGCAACAATGTGGTTCCTATTCTCGAGAATAGGAACCACATTGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004663.3-588s21c1
Sequence:CCGGTCGGCCCTAGACTCTACAAATCTCGAGATTTGTAGAGTCTAGGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017382
VALIDATED
RAB11A MISSION shRNA Bacterial Glycerol Stock
RAB11A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-385s21c1
Sequence:CCGGAGTAGGTGCCTTATTGGTTTACTCGAGTAAACCAATAAGGCACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017382.4-1087s21c1
Sequence:CCGGCACTTGAAGTTTAGACCTATTCTCGAGAATAGGTCTAAACTTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-460s21c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017382.2-163s1c1
Sequence:CCGGACCTCTTTAAAGTTGTCCTTACTCGAGTAAGGACAACTTTAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017382.2-1221s1c1
Sequence:CCGGCCCTGTAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-461s1c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-643s1c1
Sequence:CCGGCAGAGATATACCGCATTGTTTCTCGAGAAACAATGCGGTATATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-353s1c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017382.4-352s21c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-208s21c1
Sequence:CCGGTAACCTCCTGTCTCGATTTACCTCGAGGTAAATCGAGACAGGAGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017382
VALIDATED
RAB11A MISSION shRNA shRNA Plasmid DNA
RAB11A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-385s21c1
Sequence:CCGGAGTAGGTGCCTTATTGGTTTACTCGAGTAAACCAATAAGGCACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017382.4-1087s21c1
Sequence:CCGGCACTTGAAGTTTAGACCTATTCTCGAGAATAGGTCTAAACTTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-460s21c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017382.2-163s1c1
Sequence:CCGGACCTCTTTAAAGTTGTCCTTACTCGAGTAAGGACAACTTTAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017382.2-1221s1c1
Sequence:CCGGCCCTGTAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-461s1c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-643s1c1
Sequence:CCGGCAGAGATATACCGCATTGTTTCTCGAGAAACAATGCGGTATATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-353s1c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017382.4-352s21c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-208s21c1
Sequence:CCGGTAACCTCCTGTCTCGATTTACCTCGAGGTAAATCGAGACAGGAGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017382
VALIDATED
RAB11A MISSION shRNA Lentiviral Transduction Particles
RAB11A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-385s21c1
Sequence:CCGGAGTAGGTGCCTTATTGGTTTACTCGAGTAAACCAATAAGGCACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017382.4-1087s21c1
Sequence:CCGGCACTTGAAGTTTAGACCTATTCTCGAGAATAGGTCTAAACTTCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-460s21c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017382.2-163s1c1
Sequence:CCGGACCTCTTTAAAGTTGTCCTTACTCGAGTAAGGACAACTTTAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017382.2-1221s1c1
Sequence:CCGGCCCTGTAAACATAACAGCATTCTCGAGAATGCTGTTATGTTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-461s1c1
Sequence:CCGGGAGAGATCATGCTGATAGTAACTCGAGTTACTATCAGCATGATCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-643s1c1
Sequence:CCGGCAGAGATATACCGCATTGTTTCTCGAGAAACAATGCGGTATATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017382.2-353s1c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017382.4-352s21c1
Sequence:CCGGCAGGGCTATAACGTCTGCATACTCGAGTATGCAGACGTTATAGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017382.4-208s21c1
Sequence:CCGGTAACCTCCTGTCTCGATTTACCTCGAGGTAAATCGAGACAGGAGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)