EMAIL THIS PAGE TO A FRIEND

RAB11B

RAB11B, member RAS oncogene family

52 Gene Product Result for
Synonyms: H-YPT3
UniProtKB ID: Q15907, B2R7I4, D6W671, Q2YDT2, Q8NI07
Gene ID:
Human(9230) Summary: The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]
Mouse(19326) RAB11B, member RAS oncogene family
Rat(79434) RAB11B, member RAS oncogene family
chicken(420063) RAB11B, member RAS oncogene family
dog(611619) RAB11B, member RAS oncogene family
domestic cat(101090493) RAB11B, member RAS oncogene family
domestic guinea pig(100713700) RAB11B, member RAS oncogene family
naked mole-rat(101719702) RAB11B, member RAS oncogene family
cow(532723) RAB11B, member RAS oncogene family
Goat(100860975) RAB11B, member RAS oncogene family
sheep(101103562) RAB11B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0243 AQUA Peptide STIGVEFAT[R] Drosophila melanogaster, African clawed frog, bakers yeast, chicken, cow, dog, honey bee, human, mouse, rat, soybean, wheat pricing
AQ0242 AQUA Peptide HLTYENVE[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119931 MISSION® esiRNA esiRNA human RAB11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004218 Rosetta Predictions human pricing
NM_032617 Rosetta Predictions rat pricing
NM_008997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220872 predicted 416
2 SASI_Hs01_00220873 predicted 416
3 SASI_Hs01_00220875 predicted 224
4 SASI_Hs01_00220876 predicted 283
5 SASI_Hs01_00220877 predicted 461
6 SASI_Hs01_00220878 predicted 457
7 SASI_Hs01_00220879 predicted 222
8 SASI_Hs02_00337128 predicted 463
9 SASI_Hs01_00220880 predicted 339
10 SASI_Hs01_00220881 predicted 472
11 SASI_Hs01_00220874 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099747 predicted 1152
2 SASI_Rn01_00099748 predicted 380
3 SASI_Rn01_00099749 predicted 523
4 SASI_Rn01_00099750 predicted 548
5 SASI_Rn01_00099751 predicted 300
6 SASI_Rn01_00099752 predicted 511
7 SASI_Rn01_00099753 predicted 659
8 SASI_Rn01_00099754 predicted 931
9 SASI_Rn01_00099755 predicted 1106
10 SASI_Rn02_00265485 predicted 994
11 SASI_Rn01_00099756 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315111 predicted 602
2 SASI_Mm01_00117954 predicted 386
3 SASI_Mm01_00117956 predicted 479
4 SASI_Mm01_00117957 predicted 1314
5 SASI_Mm02_00315112 predicted 305
6 SASI_Mm01_00117958 predicted 560
7 SASI_Mm02_00315113 predicted 304
8 SASI_Mm02_00315114 predicted 313
9 SASI_Mm01_00117960 predicted 500
10 SASI_Mm02_00315115 predicted 662
11 SASI_Mm01_00117955 predicted 359
12 SASI_Mm01_00117959 predicted 251
13 SASI_Mm01_00117961 predicted 314
14 SASI_Mm01_00117962 predicted 1143
15 SASI_Mm01_00117963 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004218
RAB11B MISSION shRNA Bacterial Glycerol Stock
RAB11B, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004218.3-951s21c1
Sequence:GTACCGGTTTGCTGCACCCATGAAACTCCTCGAGGAGTTTCATGGGTGCAGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-435s21c1
Sequence:GTACCGGAGACAGCAACATCGTCATCATCTCGAGATGATGACGATGTTGCTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-536s21c1
Sequence:GTACCGGACTTGTCCTTCATCGAGACCTCTCGAGAGGTCTCGATGAAGGACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-587s21c1
Sequence:GTACCGGCATTCAAGAACATCCTCACAGCTCGAGCTGTGAGGATGTTCTTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-548s21c1
Sequence:GTACCGGTCGAGACCTCAGCCTTGGATTCTCGAGAATCCAAGGCTGAGGTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-186s21c1
Sequence:GTACCGGCTTCACCCGCAACGAGTTCAACTCGAGTTGAACTCGTTGCGGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-128s21c1
Sequence:GTACCGGTATTCAAAGTGGTGCTCATCGCTCGAGCGATGAGCACCACTTTGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-603s21c1
Sequence:GTACCGGCACAGAGATCTACCGCATCGTCTCGAGACGATGCGGTAGATCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-469s1c1
Sequence:CCGGGCCTTGGATTCCACTAACGTACTCGAGTACGTTAGTGGAATCCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-486s1c1
Sequence:CCGGCGTAGAGGAAGCATTCAAGAACTCGAGTTCTTGAATGCTTCCTCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-288s1c1
Sequence:CCGGCAAGCACCTGACCTATGAGAACTCGAGTTCTCATAGGTCAGGTGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-479s1c1
Sequence:CCGGCCACTAACGTAGAGGAAGCATCTCGAGATGCTTCCTCTACGTTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-36s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTCATCTCGAGATGAGCACCACTTTGAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004218
RAB11B MISSION shRNA shRNA Plasmid DNA
RAB11B, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004218.3-951s21c1
Sequence:GTACCGGTTTGCTGCACCCATGAAACTCCTCGAGGAGTTTCATGGGTGCAGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-435s21c1
Sequence:GTACCGGAGACAGCAACATCGTCATCATCTCGAGATGATGACGATGTTGCTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-536s21c1
Sequence:GTACCGGACTTGTCCTTCATCGAGACCTCTCGAGAGGTCTCGATGAAGGACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-587s21c1
Sequence:GTACCGGCATTCAAGAACATCCTCACAGCTCGAGCTGTGAGGATGTTCTTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-548s21c1
Sequence:GTACCGGTCGAGACCTCAGCCTTGGATTCTCGAGAATCCAAGGCTGAGGTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-186s21c1
Sequence:GTACCGGCTTCACCCGCAACGAGTTCAACTCGAGTTGAACTCGTTGCGGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-128s21c1
Sequence:GTACCGGTATTCAAAGTGGTGCTCATCGCTCGAGCGATGAGCACCACTTTGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-603s21c1
Sequence:GTACCGGCACAGAGATCTACCGCATCGTCTCGAGACGATGCGGTAGATCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-469s1c1
Sequence:CCGGGCCTTGGATTCCACTAACGTACTCGAGTACGTTAGTGGAATCCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-486s1c1
Sequence:CCGGCGTAGAGGAAGCATTCAAGAACTCGAGTTCTTGAATGCTTCCTCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-288s1c1
Sequence:CCGGCAAGCACCTGACCTATGAGAACTCGAGTTCTCATAGGTCAGGTGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-479s1c1
Sequence:CCGGCCACTAACGTAGAGGAAGCATCTCGAGATGCTTCCTCTACGTTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-36s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTCATCTCGAGATGAGCACCACTTTGAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004218
RAB11B MISSION shRNA Lentiviral Transduction Particles
RAB11B, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004218.3-951s21c1
Sequence:GTACCGGTTTGCTGCACCCATGAAACTCCTCGAGGAGTTTCATGGGTGCAGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-435s21c1
Sequence:GTACCGGAGACAGCAACATCGTCATCATCTCGAGATGATGACGATGTTGCTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-536s21c1
Sequence:GTACCGGACTTGTCCTTCATCGAGACCTCTCGAGAGGTCTCGATGAAGGACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-587s21c1
Sequence:GTACCGGCATTCAAGAACATCCTCACAGCTCGAGCTGTGAGGATGTTCTTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-548s21c1
Sequence:GTACCGGTCGAGACCTCAGCCTTGGATTCTCGAGAATCCAAGGCTGAGGTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-186s21c1
Sequence:GTACCGGCTTCACCCGCAACGAGTTCAACTCGAGTTGAACTCGTTGCGGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-128s21c1
Sequence:GTACCGGTATTCAAAGTGGTGCTCATCGCTCGAGCGATGAGCACCACTTTGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004218.3-603s21c1
Sequence:GTACCGGCACAGAGATCTACCGCATCGTCTCGAGACGATGCGGTAGATCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-469s1c1
Sequence:CCGGGCCTTGGATTCCACTAACGTACTCGAGTACGTTAGTGGAATCCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-486s1c1
Sequence:CCGGCGTAGAGGAAGCATTCAAGAACTCGAGTTCTTGAATGCTTCCTCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-288s1c1
Sequence:CCGGCAAGCACCTGACCTATGAGAACTCGAGTTCTCATAGGTCAGGTGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-479s1c1
Sequence:CCGGCCACTAACGTAGAGGAAGCATCTCGAGATGCTTCCTCTACGTTAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004218.1-36s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTCATCTCGAGATGAGCACCACTTTGAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008997
VALIDATED
RAB11B MISSION shRNA Bacterial Glycerol Stock
RAB11B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-254s21c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-728s21c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008997.3-1747s21c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-335s21c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-395s21c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-1559s1c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-65s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-146s1c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-206s1c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-539s1c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008997
VALIDATED
RAB11B MISSION shRNA shRNA Plasmid DNA
RAB11B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-254s21c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-728s21c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008997.3-1747s21c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-335s21c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-395s21c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-1559s1c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-65s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-146s1c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-206s1c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-539s1c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008997
VALIDATED
RAB11B MISSION shRNA Lentiviral Transduction Particles
RAB11B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-254s21c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-728s21c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008997.3-1747s21c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-335s21c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008997.3-395s21c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-1559s1c1
Sequence:CCGGCCTGTCTGCAAGTGAAGCAATCTCGAGATTGCTTCACTTGCAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-65s1c1
Sequence:CCGGCCTATTCAAAGTGGTGCTTATCTCGAGATAAGCACCACTTTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008997.1-146s1c1
Sequence:CCGGCCTAGAGAGCAAGAGTACCATCTCGAGATGGTACTCTTGCTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-206s1c1
Sequence:CCGGCAAGACCATCAAGGCTCAGATCTCGAGATCTGAGCCTTGATGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008997.1-539s1c1
Sequence:CCGGCCTCACAGAAATCTACCGTATCTCGAGATACGGTAGATTTCTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)