EMAIL THIS PAGE TO A FRIEND

RAB11FIP2

RAB11 family interacting protein 2 (class I)

132 Gene Product Result for
Synonyms: Rab11-FIP2 nRip11
UniProtKB ID: Q7L804, A6NEI4, Q9Y2F0
Gene ID:
Mouse(74998) RAB11 family interacting protein 2 (class I)
Rat(308003) RAB11 family interacting protein 2 (class I)
chicken(423924) RAB11 family interacting protein 2 (class I)
domestic cat(101084742) RAB11 family interacting protein 2 (class I)
dog(477834) RAB11 family interacting protein 2 (class I)
domestic guinea pig(100720306) RAB11 family interacting protein 2 (class I)
Domestic Rabbit(100356064) RAB11 family interacting protein 2 (class I)
naked mole-rat(101724135) RAB11 family interacting protein 2 (class I)
cow(540709) RAB11 family interacting protein 2 (class I)
sheep(101105457) RAB11 family interacting protein 2 (class I)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014904 Rosetta Predictions human pricing
NM_001107447 Rosetta Predictions rat pricing
NM_001033172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346539 predicted 1299
2 SASI_Hs02_00346540 predicted 1601
3 SASI_Hs01_00123861 predicted 1224
4 SASI_Hs01_00123862 predicted 1773
5 SASI_Hs01_00123863 predicted 1284
6 SASI_Hs01_00123864 predicted 882
7 SASI_Hs02_00346541 predicted 1252
8 SASI_Hs01_00123865 predicted 1670
9 SASI_Hs01_00123866 predicted 1577
10 SASI_Hs01_00123867 predicted 849
11 SASI_Hs01_00123860 predicted 1600
12 SASI_Hs01_00123868 predicted 1711
13 SASI_Hs01_00123869 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228915 predicted 467
2 SASI_Rn02_00228916 predicted 953
3 SASI_Rn02_00228917 predicted 439
4 SASI_Rn02_00228918 predicted 1097
5 SASI_Rn02_00228919 predicted 674
6 SASI_Rn02_00228920 predicted 1135
7 SASI_Rn02_00228921 predicted 784
8 SASI_Rn02_00228922 predicted 844
9 SASI_Rn02_00228923 predicted 820
10 SASI_Rn02_00228924 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121099 predicted 774
2 SASI_Mm01_00121100 predicted 715
3 SASI_Mm01_00121101 predicted 1107
4 SASI_Mm01_00121103 predicted 759
5 SASI_Mm01_00121104 predicted 671
6 SASI_Mm01_00121105 predicted 1601
7 SASI_Mm01_00121106 predicted 1120
8 SASI_Mm01_00121107 predicted 1321
9 SASI_Mm02_00288276 predicted 713
10 SASI_Mm01_00121108 predicted 1208
11 SASI_Mm01_00121102 predicted 1366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014904
VALIDATED
RAB11FIP2 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 2 (class I)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1111s21c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-539s21c1
Sequence:CCGGCAATGACACATACACTATAATCTCGAGATTATAGTGTATGTGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014904.2-2385s21c1
Sequence:CCGGAGGAATACTGCTCGTTATAAACTCGAGTTTATAACGAGCAGTATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-737s21c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1320s21c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-737s1c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3500s1c1
Sequence:CCGGCCGATATAATAGTTTGGGTTTCTCGAGAAACCCAAACTATTATATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3156s1c1
Sequence:CCGGCCACCCTTTAAGAATTGATTTCTCGAGAAATCAATTCTTAAAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1111s1c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1196s1c1
Sequence:CCGGCGGACACCAGTTAGATTCCTTCTCGAGAAGGAATCTAACTGGTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-5833s1c1
Sequence:CCGGGCGGGTATTTGAAAGATAGAACTCGAGTTCTATCTTTCAAATACCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1320s1c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-2647s1c1
Sequence:CCGGGCTTCAAATCACTCTTGACTACTCGAGTAGTCAAGAGTGATTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-883s1c1
Sequence:CCGGCCGCAAGTATGTTTGACTTATCTCGAGATAAGTCAAACATACTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-755s1c1
Sequence:CCGGCAATGACATCTTTGAGGACAACTCGAGTTGTCCTCAAAGATGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014904
VALIDATED
RAB11FIP2 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 2 (class I)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1111s21c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-539s21c1
Sequence:CCGGCAATGACACATACACTATAATCTCGAGATTATAGTGTATGTGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014904.2-2385s21c1
Sequence:CCGGAGGAATACTGCTCGTTATAAACTCGAGTTTATAACGAGCAGTATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-737s21c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1320s21c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-737s1c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3500s1c1
Sequence:CCGGCCGATATAATAGTTTGGGTTTCTCGAGAAACCCAAACTATTATATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3156s1c1
Sequence:CCGGCCACCCTTTAAGAATTGATTTCTCGAGAAATCAATTCTTAAAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1111s1c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1196s1c1
Sequence:CCGGCGGACACCAGTTAGATTCCTTCTCGAGAAGGAATCTAACTGGTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-5833s1c1
Sequence:CCGGGCGGGTATTTGAAAGATAGAACTCGAGTTCTATCTTTCAAATACCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1320s1c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-2647s1c1
Sequence:CCGGGCTTCAAATCACTCTTGACTACTCGAGTAGTCAAGAGTGATTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-883s1c1
Sequence:CCGGCCGCAAGTATGTTTGACTTATCTCGAGATAAGTCAAACATACTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-755s1c1
Sequence:CCGGCAATGACATCTTTGAGGACAACTCGAGTTGTCCTCAAAGATGTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014904
VALIDATED
RAB11FIP2 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 2 (class I)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1111s21c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-539s21c1
Sequence:CCGGCAATGACACATACACTATAATCTCGAGATTATAGTGTATGTGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014904.2-2385s21c1
Sequence:CCGGAGGAATACTGCTCGTTATAAACTCGAGTTTATAACGAGCAGTATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-737s21c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014904.2-1320s21c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-737s1c1
Sequence:CCGGGCAGGTGGCAATCAATCTCAACTCGAGTTGAGATTGATTGCCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3500s1c1
Sequence:CCGGCCGATATAATAGTTTGGGTTTCTCGAGAAACCCAAACTATTATATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-3156s1c1
Sequence:CCGGCCACCCTTTAAGAATTGATTTCTCGAGAAATCAATTCTTAAAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1111s1c1
Sequence:CCGGCAGCGCATTCAATGTCTGATTCTCGAGAATCAGACATTGAATGCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1196s1c1
Sequence:CCGGCGGACACCAGTTAGATTCCTTCTCGAGAAGGAATCTAACTGGTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-5833s1c1
Sequence:CCGGGCGGGTATTTGAAAGATAGAACTCGAGTTCTATCTTTCAAATACCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014904.1-1320s1c1
Sequence:CCGGGAATTGTGTTTCGGAAGACAACTCGAGTTGTCTTCCGAAACACAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014904.1-2647s1c1
Sequence:CCGGGCTTCAAATCACTCTTGACTACTCGAGTAGTCAAGAGTGATTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014904.1-883s1c1
Sequence:CCGGCCGCAAGTATGTTTGACTTATCTCGAGATAAGTCAAACATACTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014904.1-755s1c1
Sequence:CCGGCAATGACATCTTTGAGGACAACTCGAGTTGTCCTCAAAGATGTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033172
RAB11FIP2 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 2 (class I)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1365s1c1
Sequence:CCGGGCAGCATGAATTTATTCTCAACTCGAGTTGAGAATAAATTCATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1063s1c1
Sequence:CCGGGTCCCACTTATCTTCTGAGAACTCGAGTTCTCAGAAGATAAGTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1319s1c1
Sequence:CCGGCCAAGGAAGAAGAATCCATTTCTCGAGAAATGGATTCTTCTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1037s1c1
Sequence:CCGGGCCCATTCGATGTCTGATTTACTCGAGTAAATCAGACATCGAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033172
RAB11FIP2 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 2 (class I)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1365s1c1
Sequence:CCGGGCAGCATGAATTTATTCTCAACTCGAGTTGAGAATAAATTCATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1063s1c1
Sequence:CCGGGTCCCACTTATCTTCTGAGAACTCGAGTTCTCAGAAGATAAGTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1319s1c1
Sequence:CCGGCCAAGGAAGAAGAATCCATTTCTCGAGAAATGGATTCTTCTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1037s1c1
Sequence:CCGGGCCCATTCGATGTCTGATTTACTCGAGTAAATCAGACATCGAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033172
RAB11FIP2 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 2 (class I)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1365s1c1
Sequence:CCGGGCAGCATGAATTTATTCTCAACTCGAGTTGAGAATAAATTCATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1063s1c1
Sequence:CCGGGTCCCACTTATCTTCTGAGAACTCGAGTTCTCAGAAGATAAGTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1319s1c1
Sequence:CCGGCCAAGGAAGAAGAATCCATTTCTCGAGAAATGGATTCTTCTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033172.1-1037s1c1
Sequence:CCGGGCCCATTCGATGTCTGATTTACTCGAGTAAATCAGACATCGAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)