EMAIL THIS PAGE TO A FRIEND

RAB11FIP3

RAB11 family interacting protein 3 (class II)

196 Gene Product Result for
Synonyms: CART1 Rab11-FIP3
Gene ID:
Human(9727) Summary: Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]
Mouse(215445) RAB11 family interacting protein 3 (class II)
Rat(303002) RAB11 family interacting protein 3 (class II)
cow(511647) RAB11 family interacting protein 3 (class II)
sheep(101123176) RAB11 family interacting protein 3 (class II)
naked mole-rat(101723986) RAB11 family interacting protein 3 (class II)
Domestic Rabbit(100338794) RAB11 family interacting protein 3 (class II)
domestic guinea pig(100719645) RAB11 family interacting protein 3 (class II)
Zebrafish(573631) RAB11 family interacting protein 3 (class II)
domestic cat(101095304) RAB11 family interacting protein 3 (class II)
dog(100688052) RAB11 family interacting protein 3 (class II)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_484616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014700 Rosetta Predictions human pricing
XM_001062633 Rosetta Predictions rat pricing
XM_001062691 Rosetta Predictions rat pricing
XM_220262 Rosetta Predictions rat pricing
XM_001479926 Rosetta Predictions mouse pricing
XM_484616 Rosetta Predictions mouse pricing
XM_899020 Rosetta Predictions mouse pricing
XM_899034 Rosetta Predictions mouse pricing
XM_899040 Rosetta Predictions mouse pricing
XM_899046 Rosetta Predictions mouse pricing
XM_899052 Rosetta Predictions mouse pricing
XM_899059 Rosetta Predictions mouse pricing
XM_914406 Rosetta Predictions mouse pricing
XM_923228 Rosetta Predictions mouse pricing
XM_989054 Rosetta Predictions mouse pricing
XM_990883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132930 predicted 3072
2 SASI_Hs02_00346108 predicted 1702
3 SASI_Hs01_00132931 predicted 1258
4 SASI_Hs02_00346109 predicted 2025
5 SASI_Hs01_00132932 predicted 2919
6 SASI_Hs01_00132933 predicted 2491
7 SASI_Hs01_00132934 predicted 1599
8 SASI_Hs01_00132936 predicted 1715
9 SASI_Hs01_00132938 predicted 1005
10 SASI_Hs01_00132939 predicted 1154
11 SASI_Hs01_00132935 predicted 2382
12 SASI_Hs01_00132937 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304049 predicted 808
2 SASI_Rn02_00304050 predicted 1829
3 SASI_Rn02_00304051 predicted 1562
4 SASI_Rn02_00304052 predicted 1561
5 SASI_Rn02_00304053 predicted 1527
6 SASI_Rn02_00304054 predicted 1047
7 SASI_Rn02_00304055 predicted 1392
8 SASI_Rn02_00304056 predicted 1651
9 SASI_Rn02_00304057 predicted 1027
10 SASI_Rn02_00304058 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304242 predicted 2340
2 SASI_Rn02_00304243 predicted 583
3 SASI_Rn02_00304244 predicted 580
4 SASI_Rn02_00304245 predicted 647
5 SASI_Rn02_00304246 predicted 3092
6 SASI_Rn02_00304247 predicted 2025
7 SASI_Rn02_00304248 predicted 3089
8 SASI_Rn02_00304249 predicted 3059
9 SASI_Rn02_00304250 predicted 2579
10 SASI_Rn02_00304251 predicted 2926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379185 predicted 809
2 SASI_Rn02_00379186 predicted 1828
3 SASI_Rn02_00379187 predicted 1557
4 SASI_Rn02_00379188 predicted 1560
5 SASI_Rn02_00379189 predicted 1530
6 SASI_Rn02_00379190 predicted 1052
7 SASI_Rn02_00379191 predicted 1393
8 SASI_Rn02_00379192 predicted 1653
9 SASI_Rn02_00379193 predicted 1035
10 SASI_Rn02_00379194 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413721 predicted 2386
2 SASI_Mm02_00413722 predicted 3481
3 SASI_Mm02_00413723 predicted 2974
4 SASI_Mm02_00413724 predicted 3016
5 SASI_Mm02_00413725 predicted 2694
6 SASI_Mm02_00413726 predicted 2730
7 SASI_Mm02_00413727 predicted 2349
8 SASI_Mm02_00413728 predicted 2843
9 SASI_Mm02_00413729 predicted 2485
10 SASI_Mm02_00413730 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277488 predicted 3615
2 SASI_Mm01_00277489 predicted 3149
3 SASI_Mm01_00277490 predicted 2837
4 SASI_Mm01_00277491 predicted 2969
5 SASI_Mm01_00277492 predicted 2936
6 SASI_Mm01_00277493 predicted 2876
7 SASI_Mm01_00277494 predicted 3590
8 SASI_Mm01_00277495 predicted 2901
9 SASI_Mm02_00426498 predicted 3144
10 SASI_Mm01_00277496 predicted 2924
11 SASI_Mm01_00277497 predicted 3078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274804 predicted 1610
2 SASI_Mm01_00274805 predicted 1136
3 SASI_Mm01_00274806 predicted 821
4 SASI_Mm01_00274807 predicted 962
5 SASI_Mm01_00274808 predicted 929
6 SASI_Mm01_00274809 predicted 865
7 SASI_Mm01_00274810 predicted 1589
8 SASI_Mm01_00274811 predicted 893
9 SASI_Mm01_00274812 predicted 919
10 SASI_Mm01_00274813 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239205 predicted 1098
2 SASI_Mm01_00239206 predicted 1029
3 SASI_Mm01_00239207 predicted 926
4 SASI_Mm01_00239208 predicted 1075
5 SASI_Mm01_00239209 predicted 960
6 SASI_Mm01_00239210 predicted 890
7 SASI_Mm01_00239211 predicted 598
8 SASI_Mm01_00239212 predicted 1163
9 SASI_Mm01_00239213 predicted 1116
10 SASI_Mm01_00239214 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205497 predicted 944
2 SASI_Mm01_00205498 predicted 1643
3 SASI_Mm01_00205499 predicted 2049
4 SASI_Mm01_00205500 predicted 1924
5 SASI_Mm01_00205501 predicted 711
6 SASI_Mm01_00205502 predicted 1046
7 SASI_Mm01_00205503 predicted 1659
8 SASI_Mm01_00205504 predicted 2020
9 SASI_Mm01_00205505 predicted 1429
10 SASI_Mm01_00205506 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280947 predicted 944
2 SASI_Mm01_00280948 predicted 1641
3 SASI_Mm01_00280949 predicted 1931
4 SASI_Mm01_00280950 predicted 1055
5 SASI_Mm01_00280951 predicted 2045
6 SASI_Mm01_00280952 predicted 2064
7 SASI_Mm01_00280953 predicted 1662
8 SASI_Mm01_00280954 predicted 1432
9 SASI_Mm01_00280955 predicted 1974
10 SASI_Mm01_00280956 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221091 predicted 1077
2 SASI_Mm01_00221092 predicted 612
3 SASI_Mm01_00221093 predicted 438
4 SASI_Mm01_00221094 predicted 402
5 SASI_Mm01_00221095 predicted 345
6 SASI_Mm01_00221096 predicted 1058
7 SASI_Mm01_00221097 predicted 364
8 SASI_Mm01_00221098 predicted 610
9 SASI_Mm01_00221099 predicted 391
10 SASI_Mm01_00221100 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223402 predicted 1756
2 SASI_Mm01_00223403 predicted 1292
3 SASI_Mm01_00223404 predicted 977
4 SASI_Mm01_00223405 predicted 1115
5 SASI_Mm01_00223406 predicted 1085
6 SASI_Mm01_00223407 predicted 1025
7 SASI_Mm01_00223408 predicted 1733
8 SASI_Mm01_00223409 predicted 1049
9 SASI_Mm01_00223410 predicted 1072
10 SASI_Mm01_00223411 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438517 predicted 2719
2 SASI_Mm02_00438518 predicted 3614
3 SASI_Mm02_00438519 predicted 1990
4 SASI_Mm02_00438520 predicted 1999
5 SASI_Mm02_00438521 predicted 3578
6 SASI_Mm02_00438522 predicted 2541
7 SASI_Mm02_00438523 predicted 1434
8 SASI_Mm02_00438524 predicted 2930
9 SASI_Mm02_00438525 predicted 733
10 SASI_Mm02_00438526 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443711 predicted 455
2 SASI_Mm02_00443712 predicted 1544
3 SASI_Mm02_00443713 predicted 1077
4 SASI_Mm02_00443714 predicted 761
5 SASI_Mm02_00443715 predicted 1496
6 SASI_Mm02_00443716 predicted 320
7 SASI_Mm02_00443717 predicted 899
8 SASI_Mm02_00443718 predicted 1414
9 SASI_Mm02_00443719 predicted 859
10 SASI_Mm02_00443720 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220697 predicted 453
2 SASI_Mm01_00220698 predicted 1542
3 SASI_Mm01_00220699 predicted 1027
4 SASI_Mm01_00220700 predicted 1076
5 SASI_Mm01_00220701 predicted 756
6 SASI_Mm01_00220702 predicted 797
7 SASI_Mm01_00220703 predicted 409
8 SASI_Mm01_00220704 predicted 323
9 SASI_Mm01_00220705 predicted 894
10 SASI_Mm01_00220706 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450446 predicted 2582
2 SASI_Mm02_00450447 predicted 3486
3 SASI_Mm02_00450448 predicted 1992
4 SASI_Mm02_00450449 predicted 2006
5 SASI_Mm02_00450450 predicted 3448
6 SASI_Mm02_00450451 predicted 1430
7 SASI_Mm02_00450452 predicted 2795
8 SASI_Mm02_00450453 predicted 729
9 SASI_Mm02_00450454 predicted 2105
10 SASI_Mm02_00450455 predicted 3415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153140
RAB11FIP3 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 3 (class II)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1421s21c1
Sequence:CCGGGCTCATGGAAGCAATCCAGAACTCGAGTTCTGGATTGCTTCCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1311s21c1
Sequence:CCGGGAGCTAAATGGGCAGATCATCCTCGAGGATGATCTGCCCATTTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-419s21c1
Sequence:CCGGGATTGGCAGTGAGGAACATTTCTCGAGAAATGTTCCTCACTGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-807s21c1
Sequence:CCGGGCCCAAGAGAAGGTCCTAGAACTCGAGTTCTAGGACCTTCTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1867s21c1
Sequence:CCGGTTTCTGCTATGCGCCCTATTACTCGAGTAATAGGGCGCATAGCAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-455s21c1
Sequence:CCGGGGGCAATGAGGCAGAACTATCCTCGAGGATAGTTCTGCCTCATTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1813s21c1
Sequence:CCGGTGCTCAGCAGTATGCAGATATCTCGAGATATCTGCATACTGCTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1272s21c1
Sequence:CCGGCTCAAACAGGACAACCGTAACCTCGAGGTTACGGTTGTCCTGTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1398s21c1
Sequence:CCGGATCAGCTCTGTCTCCCGAGATCTCGAGATCTCGGGAGACAGAGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153140
RAB11FIP3 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 3 (class II)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1421s21c1
Sequence:CCGGGCTCATGGAAGCAATCCAGAACTCGAGTTCTGGATTGCTTCCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1311s21c1
Sequence:CCGGGAGCTAAATGGGCAGATCATCCTCGAGGATGATCTGCCCATTTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-419s21c1
Sequence:CCGGGATTGGCAGTGAGGAACATTTCTCGAGAAATGTTCCTCACTGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-807s21c1
Sequence:CCGGGCCCAAGAGAAGGTCCTAGAACTCGAGTTCTAGGACCTTCTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1867s21c1
Sequence:CCGGTTTCTGCTATGCGCCCTATTACTCGAGTAATAGGGCGCATAGCAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-455s21c1
Sequence:CCGGGGGCAATGAGGCAGAACTATCCTCGAGGATAGTTCTGCCTCATTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1813s21c1
Sequence:CCGGTGCTCAGCAGTATGCAGATATCTCGAGATATCTGCATACTGCTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1272s21c1
Sequence:CCGGCTCAAACAGGACAACCGTAACCTCGAGGTTACGGTTGTCCTGTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1398s21c1
Sequence:CCGGATCAGCTCTGTCTCCCGAGATCTCGAGATCTCGGGAGACAGAGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153140
RAB11FIP3 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 3 (class II)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1421s21c1
Sequence:CCGGGCTCATGGAAGCAATCCAGAACTCGAGTTCTGGATTGCTTCCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1311s21c1
Sequence:CCGGGAGCTAAATGGGCAGATCATCCTCGAGGATGATCTGCCCATTTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-419s21c1
Sequence:CCGGGATTGGCAGTGAGGAACATTTCTCGAGAAATGTTCCTCACTGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-807s21c1
Sequence:CCGGGCCCAAGAGAAGGTCCTAGAACTCGAGTTCTAGGACCTTCTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1867s21c1
Sequence:CCGGTTTCTGCTATGCGCCCTATTACTCGAGTAATAGGGCGCATAGCAGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-455s21c1
Sequence:CCGGGGGCAATGAGGCAGAACTATCCTCGAGGATAGTTCTGCCTCATTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153140.2-1813s21c1
Sequence:CCGGTGCTCAGCAGTATGCAGATATCTCGAGATATCTGCATACTGCTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1272s21c1
Sequence:CCGGCTCAAACAGGACAACCGTAACCTCGAGGTTACGGTTGTCCTGTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153140.2-1398s21c1
Sequence:CCGGATCAGCTCTGTCTCCCGAGATCTCGAGATCTCGGGAGACAGAGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484616
VALIDATED
RAB11FIP3 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 3 (class II)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-1854s1c1
Sequence:CCGGGCCGATGAGTTTGACGACTTTCTCGAGAAAGTCGTCAAACTCATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2499s1c1
Sequence:CCGGGCAGACAAGGTCATCTTCCTACTCGAGTAGGAAGATGACCTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484616.1-1165s1c1
Sequence:CCGGCCGATGCACTTCACTGTTGTTCTCGAGAACAACAGTGAAGTGCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2720s1c1
Sequence:CCGGGAAGAGCATTGAGATCGAGAACTCGAGTTCTCGATCTCAATGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484616
VALIDATED
RAB11FIP3 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 3 (class II)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-1854s1c1
Sequence:CCGGGCCGATGAGTTTGACGACTTTCTCGAGAAAGTCGTCAAACTCATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2499s1c1
Sequence:CCGGGCAGACAAGGTCATCTTCCTACTCGAGTAGGAAGATGACCTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484616.1-1165s1c1
Sequence:CCGGCCGATGCACTTCACTGTTGTTCTCGAGAACAACAGTGAAGTGCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2720s1c1
Sequence:CCGGGAAGAGCATTGAGATCGAGAACTCGAGTTCTCGATCTCAATGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484616
VALIDATED
RAB11FIP3 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 3 (class II)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-1854s1c1
Sequence:CCGGGCCGATGAGTTTGACGACTTTCTCGAGAAAGTCGTCAAACTCATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2499s1c1
Sequence:CCGGGCAGACAAGGTCATCTTCCTACTCGAGTAGGAAGATGACCTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484616.1-1165s1c1
Sequence:CCGGCCGATGCACTTCACTGTTGTTCTCGAGAACAACAGTGAAGTGCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_484616.1-2720s1c1
Sequence:CCGGGAAGAGCATTGAGATCGAGAACTCGAGTTCTCGATCTCAATGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014700
RAB11FIP3 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 3 (class II)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1049s1c1
Sequence:CCGGGCAGGTGAAGGACTTAACTAACTCGAGTTAGTTAAGTCCTTCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1722s21c1
Sequence:CCGGCATTGCTGACAAGGTTGTCTTCTCGAGAAGACAACCTTGTCAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2540s1c1
Sequence:CCGGGCAGGACTACATCGACAGGATCTCGAGATCCTGTCGATGTAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2066s1c1
Sequence:CCGGGCAGAAGCTGTTGGATGAGATCTCGAGATCTCATCCAACAGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1019s1c1
Sequence:CCGGCATCCAGTTTGCTACGGTCTACTCGAGTAGACCGTAGCAAACTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1503s1c1
Sequence:CCGGCACTTTGAGGACTACGGTGAACTCGAGTTCACCGTAGTCCTCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1123s21c1
Sequence:CCGGGGGATCACAGCCATCAGAAACCTCGAGGTTTCTGATGGCTGTGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014700
RAB11FIP3 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 3 (class II)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1049s1c1
Sequence:CCGGGCAGGTGAAGGACTTAACTAACTCGAGTTAGTTAAGTCCTTCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1722s21c1
Sequence:CCGGCATTGCTGACAAGGTTGTCTTCTCGAGAAGACAACCTTGTCAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2540s1c1
Sequence:CCGGGCAGGACTACATCGACAGGATCTCGAGATCCTGTCGATGTAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2066s1c1
Sequence:CCGGGCAGAAGCTGTTGGATGAGATCTCGAGATCTCATCCAACAGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1019s1c1
Sequence:CCGGCATCCAGTTTGCTACGGTCTACTCGAGTAGACCGTAGCAAACTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1503s1c1
Sequence:CCGGCACTTTGAGGACTACGGTGAACTCGAGTTCACCGTAGTCCTCAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1123s21c1
Sequence:CCGGGGGATCACAGCCATCAGAAACCTCGAGGTTTCTGATGGCTGTGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014700
RAB11FIP3 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 3 (class II)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1049s1c1
Sequence:CCGGGCAGGTGAAGGACTTAACTAACTCGAGTTAGTTAAGTCCTTCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1722s21c1
Sequence:CCGGCATTGCTGACAAGGTTGTCTTCTCGAGAAGACAACCTTGTCAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2540s1c1
Sequence:CCGGGCAGGACTACATCGACAGGATCTCGAGATCCTGTCGATGTAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-2066s1c1
Sequence:CCGGGCAGAAGCTGTTGGATGAGATCTCGAGATCTCATCCAACAGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1019s1c1
Sequence:CCGGCATCCAGTTTGCTACGGTCTACTCGAGTAGACCGTAGCAAACTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014700.2-1503s1c1
Sequence:CCGGCACTTTGAGGACTACGGTGAACTCGAGTTCACCGTAGTCCTCAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014700.3-1123s21c1
Sequence:CCGGGGGATCACAGCCATCAGAAACCTCGAGGTTTCTGATGGCTGTGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)