EMAIL THIS PAGE TO A FRIEND

RAB11FIP5

RAB11 family interacting protein 5 (class I)

110 Gene Product Result for
Synonyms: GAF1 RIP11 pp75
UniProtKB ID: Q9BXF6, O94939, Q9P0M1
Gene ID:
Mouse(52055) RAB11 family interacting protein 5 (class I)
Rat(312502) RAB11 family interacting protein 5 (class I)
chicken(422952) RAB11 family interacting protein 5 (class I)
domestic cat(101097387) RAB11 family interacting protein 5 (class I)
Horse(100059236) RAB11 family interacting protein 5 (class I)
dog(483115) RAB11 family interacting protein 5 (class I)
cow(535992) RAB11 family interacting protein 5 (class I)
naked mole-rat(101709618) RAB11 family interacting protein 5 (class I)
Domestic Rabbit(100357125) RAB11 family interacting protein 5 (class I)
domestic guinea pig(100718584) RAB11 family interacting protein 5 (class I)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015470 Rosetta Predictions human pricing
XM_001073801 Rosetta Predictions rat pricing
XR_005948 Rosetta Predictions rat pricing
NM_001003955 Rosetta Predictions mouse pricing
NM_177466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077698 predicted 2542
2 SASI_Hs01_00077700 predicted 2568
3 SASI_Hs01_00077701 predicted 1233
4 SASI_Hs01_00077702 predicted 2534
5 SASI_Hs01_00077703 predicted 1649
6 SASI_Hs01_00077704 predicted 1156
7 SASI_Hs01_00077705 predicted 1076
8 SASI_Hs02_00347897 predicted 1426
9 SASI_Hs02_00347898 predicted 794
10 SASI_Hs02_00347899 predicted 763
11 SASI_Hs01_00077699 predicted 921
12 SASI_Hs01_00077706 predicted 1765
13 SASI_Hs01_00077707 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343994 predicted 2541
2 SASI_Rn02_00343995 predicted 2415
3 SASI_Rn02_00343996 predicted 1738
4 SASI_Rn02_00343997 predicted 1878
5 SASI_Rn02_00343998 predicted 3861
6 SASI_Rn02_00343999 predicted 2942
7 SASI_Rn02_00344000 predicted 2750
8 SASI_Rn02_00344001 predicted 2430
9 SASI_Rn02_00344002 predicted 757
10 SASI_Rn02_00344003 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164868 predicted 2508
2 SASI_Rn01_00164869 predicted 2384
3 SASI_Rn01_00164870 predicted 1711
4 SASI_Rn01_00164871 predicted 1848
5 SASI_Rn01_00164872 predicted 3837
6 SASI_Rn01_00164873 predicted 5604
7 SASI_Rn01_00164874 predicted 4782
8 SASI_Rn01_00164876 predicted 4314
9 SASI_Rn02_00410627 predicted 5719
10 SASI_Rn01_00164877 predicted 4513
11 SASI_Rn01_00164875 predicted 5512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130621 predicted 446
2 SASI_Mm01_00130623 predicted 4363
3 SASI_Mm01_00130624 predicted 4345
4 SASI_Mm01_00130625 predicted 712
5 SASI_Mm01_00130627 predicted 799
6 SASI_Mm01_00130628 predicted 4250
7 SASI_Mm02_00286410 predicted 579
8 SASI_Mm01_00130629 predicted 4288
9 SASI_Mm02_00286411 predicted 757
10 SASI_Mm01_00130630 predicted 776
11 SASI_Mm01_00130622 predicted 3884
12 SASI_Mm01_00130626 predicted 3970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164001 predicted 451
2 SASI_Mm01_00164003 predicted 2344
3 SASI_Mm01_00164004 predicted 2325
4 SASI_Mm01_00164005 predicted 711
5 SASI_Mm01_00164007 predicted 798
6 SASI_Mm01_00164008 predicted 2225
7 SASI_Mm02_00347670 predicted 577
8 SASI_Mm01_00164009 predicted 2265
9 SASI_Mm02_00347671 predicted 757
10 SASI_Mm01_00164010 predicted 776
11 SASI_Mm01_00164002 predicted 1866
12 SASI_Mm01_00164006 predicted 1949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015470
VALIDATED
RAB11FIP5 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 5 (class I)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-754s21c1
Sequence:CCGGCAACCTGAGCGCCAGTATGTTCTCGAGAACATACTGGCGCTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1345s21c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015470.2-2547s21c1
Sequence:CCGGGGTTGCTAGCACATACTTTATCTCGAGATAAAGTATGTGCTAGCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015470.1-3595s1c1
Sequence:CCGGGAAATGAAGTATCTGTCCTTTCTCGAGAAAGGACAGATACTTCATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1344s1c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015470.1-717s1c1
Sequence:CCGGCGGCGAGATTGAAGTCACCATCTCGAGATGGTGACTTCAATCTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1767s1c1
Sequence:CCGGGTTTGGCTTGAGAGAAGCCAACTCGAGTTGGCTTCTCTCAAGCCAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1251s21c1
Sequence:CCGGGTGTCAATGGGAGCCACATTTCTCGAGAAATGTGGCTCCCATTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1130s21c1
Sequence:CCGGCCCAAGCTGTTCACCCATAAGCTCGAGCTTATGGGTGAACAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1755s1c1
Sequence:CCGGCAAGAGTAGCTGGTTTGGCTTCTCGAGAAGCCAAACCAGCTACTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015470
VALIDATED
RAB11FIP5 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 5 (class I)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-754s21c1
Sequence:CCGGCAACCTGAGCGCCAGTATGTTCTCGAGAACATACTGGCGCTCAGGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1345s21c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015470.2-2547s21c1
Sequence:CCGGGGTTGCTAGCACATACTTTATCTCGAGATAAAGTATGTGCTAGCAACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000007152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015470.1-3595s1c1
Sequence:CCGGGAAATGAAGTATCTGTCCTTTCTCGAGAAAGGACAGATACTTCATTTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000007155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1344s1c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000007154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015470.1-717s1c1
Sequence:CCGGCGGCGAGATTGAAGTCACCATCTCGAGATGGTGACTTCAATCTCGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000007153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1767s1c1
Sequence:CCGGGTTTGGCTTGAGAGAAGCCAACTCGAGTTGGCTTCTCTCAAGCCAAACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1251s21c1
Sequence:CCGGGTGTCAATGGGAGCCACATTTCTCGAGAAATGTGGCTCCCATTGACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1130s21c1
Sequence:CCGGCCCAAGCTGTTCACCCATAAGCTCGAGCTTATGGGTGAACAGCTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1755s1c1
Sequence:CCGGCAAGAGTAGCTGGTTTGGCTTCTCGAGAAGCCAAACCAGCTACTCTTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015470
VALIDATED
RAB11FIP5 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 5 (class I)
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000368952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-754s21c1
Sequence:CCGGCAACCTGAGCGCCAGTATGTTCTCGAGAACATACTGGCGCTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1345s21c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015470.2-2547s21c1
Sequence:CCGGGGTTGCTAGCACATACTTTATCTCGAGATAAAGTATGTGCTAGCAACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015470.1-3595s1c1
Sequence:CCGGGAAATGAAGTATCTGTCCTTTCTCGAGAAAGGACAGATACTTCATTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1344s1c1
Sequence:CCGGGCAAGCTGTCTCTTCCCGGTTCTCGAGAACCGGGAAGAGACAGCTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015470.1-717s1c1
Sequence:CCGGCGGCGAGATTGAAGTCACCATCTCGAGATGGTGACTTCAATCTCGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1767s1c1
Sequence:CCGGGTTTGGCTTGAGAGAAGCCAACTCGAGTTGGCTTCTCTCAAGCCAAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1251s21c1
Sequence:CCGGGTGTCAATGGGAGCCACATTTCTCGAGAAATGTGGCTCCCATTGACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015470.2-1130s21c1
Sequence:CCGGCCCAAGCTGTTCACCCATAAGCTCGAGCTTATGGGTGAACAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015470.1-1755s1c1
Sequence:CCGGCAAGAGTAGCTGGTTTGGCTTCTCGAGAAGCCAAACCAGCTACTCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003955
VALIDATED
RAB11FIP5 MISSION shRNA Bacterial Glycerol Stock
RAB11 family interacting protein 5 (class I)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2538s21c1
Sequence:CCGGCTTGGGATGTGATCACCATTTCTCGAGAAATGGTGATCACATCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2228s21c1
Sequence:CCGGGACCAGCCAAGCACAAGTATGCTCGAGCATACTTGTGCTTGGCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-2009s1c1
Sequence:CCGGGACGACACCTTCAACATCTTTCTCGAGAAAGATGTTGAAGGTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-1904s1c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003955.2-5878s1c1
Sequence:CCGGCCTTGCTGTTTGGCTTCTCTACTCGAGTAGAGAAGCCAAACAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003955.2-4285s21c1
Sequence:CCGGGAATTGCAACAAGGTTGTTAGCTCGAGCTAACAACCTTGTTGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2894s21c1
Sequence:CCGGTCTAAGGAGGAATGGGTAAATCTCGAGATTTACCCATTCCTCCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-1904s21c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003955.2-1746s1c1
Sequence:CCGGCCATGCTAAGCACTAACCTTTCTCGAGAAAGGTTAGTGCTTAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003955
VALIDATED
RAB11FIP5 MISSION shRNA shRNA Plasmid DNA
RAB11 family interacting protein 5 (class I)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2538s21c1
Sequence:CCGGCTTGGGATGTGATCACCATTTCTCGAGAAATGGTGATCACATCCCAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2228s21c1
Sequence:CCGGGACCAGCCAAGCACAAGTATGCTCGAGCATACTTGTGCTTGGCTGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-2009s1c1
Sequence:CCGGGACGACACCTTCAACATCTTTCTCGAGAAAGATGTTGAAGGTGTCGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-1904s1c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003955.2-5878s1c1
Sequence:CCGGCCTTGCTGTTTGGCTTCTCTACTCGAGTAGAGAAGCCAAACAGCAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003955.2-4285s21c1
Sequence:CCGGGAATTGCAACAAGGTTGTTAGCTCGAGCTAACAACCTTGTTGCAATTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000297229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2894s21c1
Sequence:CCGGTCTAAGGAGGAATGGGTAAATCTCGAGATTTACCCATTCCTCCTTAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-1904s21c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003955.2-1746s1c1
Sequence:CCGGCCATGCTAAGCACTAACCTTTCTCGAGAAAGGTTAGTGCTTAGCATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003955
VALIDATED
RAB11FIP5 MISSION shRNA Lentiviral Transduction Particles
RAB11 family interacting protein 5 (class I)
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000297228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2538s21c1
Sequence:CCGGCTTGGGATGTGATCACCATTTCTCGAGAAATGGTGATCACATCCCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2228s21c1
Sequence:CCGGGACCAGCCAAGCACAAGTATGCTCGAGCATACTTGTGCTTGGCTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-2009s1c1
Sequence:CCGGGACGACACCTTCAACATCTTTCTCGAGAAAGATGTTGAAGGTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003955.2-1904s1c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003955.2-5878s1c1
Sequence:CCGGCCTTGCTGTTTGGCTTCTCTACTCGAGTAGAGAAGCCAAACAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003955.2-4285s21c1
Sequence:CCGGGAATTGCAACAAGGTTGTTAGCTCGAGCTAACAACCTTGTTGCAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-2894s21c1
Sequence:CCGGTCTAAGGAGGAATGGGTAAATCTCGAGATTTACCCATTCCTCCTTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003955.2-1904s21c1
Sequence:CCGGGCCGACATAGCACTAAATTCTCTCGAGAGAATTTAGTGCTATGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003955.2-1746s1c1
Sequence:CCGGCCATGCTAAGCACTAACCTTTCTCGAGAAAGGTTAGTGCTTAGCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)