EMAIL THIS PAGE TO A FRIEND

RAB14

RAB14, member RAS oncogene family

181 Gene Product Result for
Synonyms: FBP RAB-14
Gene ID:
Human(51552) Summary: RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]
Mouse(68365) RAB14, member RAS oncogene family
Rat(94197) RAB14, member RAS oncogene family
fruit fly(34840) CG4212 gene product from transcript CG4212-RA
Zebrafish(373104) RAB14, member RAS oncogene family
chicken(417119) RAB14, member RAS oncogene family
dog(474818) RAB14, member RAS oncogene family
domestic cat(101087882) RAB14, member RAS oncogene family
naked mole-rat(101709151) RAB14, member RAS oncogene family
domestic guinea pig(100722861) RAB14, member RAS oncogene family
cow(539180) RAB14, member RAS oncogene family
Goat(100860798) RAB14, member RAS oncogene family
sheep(101121568) RAB14, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R0656 Anti-Rab14 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
R0781 Anti-Rab14 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
AV13107 Anti-RAB14 antibody produced in rabbit affinity isolated antibody mouse, rat, dog, pig, human, bovine, goat
immunohistochemistry, western blot pricing
HPA026419 Anti-RAB14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016322 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016322 Rosetta Predictions human pricing
NM_053589 Rosetta Predictions rat pricing
NM_026697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040069 predicted 1325
2 SASI_Hs01_00040070 predicted 1234
3 SASI_Hs01_00040071 predicted 1170
4 SASI_Hs01_00040072 predicted 1214
5 SASI_Hs01_00040073 predicted 503
6 SASI_Hs01_00040074 predicted 1239
7 SASI_Hs01_00040076 predicted 1258
8 SASI_Hs02_00349261 predicted 527
9 SASI_Hs01_00040077 predicted 1156
10 SASI_Hs01_00040078 predicted 516
11 SASI_Hs01_00040075 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078729 predicted 351
2 SASI_Rn01_00078730 predicted 228
3 SASI_Rn01_00078731 predicted 347
4 SASI_Rn01_00078732 predicted 534
5 SASI_Rn01_00078733 predicted 305
6 SASI_Rn01_00078734 predicted 341
7 SASI_Rn01_00078735 predicted 353
8 SASI_Rn01_00078736 predicted 223
9 SASI_Rn01_00078737 predicted 333
10 SASI_Rn01_00078738 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186515 predicted 708
2 SASI_Mm01_00186516 predicted 899
3 SASI_Mm01_00186517 predicted 746
4 SASI_Mm01_00186518 predicted 805
5 SASI_Mm01_00186519 predicted 676
6 SASI_Mm01_00186521 predicted 586
7 SASI_Mm01_00186522 predicted 703
8 SASI_Mm02_00330740 predicted 497
9 SASI_Mm01_00186523 predicted 690
10 SASI_Mm01_00186524 predicted 669
11 SASI_Mm01_00186520 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026697
VALIDATED
RAB14 MISSION shRNA Bacterial Glycerol Stock
RAB14, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-389s1c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-706s21c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-440s1c1
Sequence:CCGGGCACAGAGAGATGTTACCTATCTCGAGATAGGTAACATCTCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-942s1c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026697.2-390s1c1
Sequence:CCGGCCAATCCAAACACTGTAATAACTCGAGTTATTACAGTGTTTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-443s1c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-593s21c1
Sequence:CCGGCGGTTACACGGAGCTACTATACTCGAGTATAGTAGCTCCGTGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-646s21c1
Sequence:CCGGATCACCAGAAGAAGTACATATCTCGAGATATGTACTTCTTCTGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-1259s21c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-760s21c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026697
VALIDATED
RAB14 MISSION shRNA shRNA Plasmid DNA
RAB14, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-389s1c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-706s21c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-440s1c1
Sequence:CCGGGCACAGAGAGATGTTACCTATCTCGAGATAGGTAACATCTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-942s1c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026697.2-390s1c1
Sequence:CCGGCCAATCCAAACACTGTAATAACTCGAGTTATTACAGTGTTTGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-443s1c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-593s21c1
Sequence:CCGGCGGTTACACGGAGCTACTATACTCGAGTATAGTAGCTCCGTGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-646s21c1
Sequence:CCGGATCACCAGAAGAAGTACATATCTCGAGATATGTACTTCTTCTGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-1259s21c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-760s21c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026697
VALIDATED
RAB14 MISSION shRNA Lentiviral Transduction Particles
RAB14, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-389s1c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-706s21c1
Sequence:CCGGACCAATCCAAACACTGTAATACTCGAGTATTACAGTGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-440s1c1
Sequence:CCGGGCACAGAGAGATGTTACCTATCTCGAGATAGGTAACATCTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-942s1c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026697.2-390s1c1
Sequence:CCGGCCAATCCAAACACTGTAATAACTCGAGTTATTACAGTGTTTGGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026697.2-443s1c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-593s21c1
Sequence:CCGGCGGTTACACGGAGCTACTATACTCGAGTATAGTAGCTCCGTGTAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-646s21c1
Sequence:CCGGATCACCAGAAGAAGTACATATCTCGAGATATGTACTTCTTCTGGTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-1259s21c1
Sequence:CCGGCCTTTGATTGTCCTTGTGATACTCGAGTATCACAAGGACAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026697.3-760s21c1
Sequence:CCGGCAGAGAGATGTTACCTATGAACTCGAGTTCATAGGTAACATCTCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016322
VALIDATED
RAB14 MISSION shRNA Bacterial Glycerol Stock
RAB14, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-595s1c1
Sequence:CCGGGAAGCCAAACAGTTTGCTGAACTCGAGTTCAGCAAACTGTTTGGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-392s1c1
Sequence:CCGGAGGAGCGATTTAGGGCTGTTACTCGAGTAACAGCCCTAAATCGCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016322.2-505s1c1
Sequence:CCGGGATGCAAGGAATCTCACCAATCTCGAGATTGGTGAGATTCCTTGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-317s1c1
Sequence:CCGGGTGTTGAATTTGGTACAAGAACTCGAGTTCTTGTACCAAATTCAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-304s1c1
Sequence:CCGGCCTCACACAATTGGTGTTGAACTCGAGTTCAACACCAATTGTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-794s21c1
Sequence:GTACCGGCCAATCCAAATACTGTAATAACTCGAGTTATTACAGTATTTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-1016s21c1
Sequence:GTACCGGAGTCTGGTGTACAACACAAACCTCGAGGTTTGTGTTGTACACCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-819s21c1
Sequence:CCGGCATAGGAAATAAAGCAGATTTCTCGAGAAATCTGCTTTATTTCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-735s21c1
Sequence:CCGGCACTAGAAGAAGTACATATAACTCGAGTTATATGTACTTCTTCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-710s21c1
Sequence:CCGGCGGGAGCTCTTATGGTCTATGCTCGAGCATAGACCATAAGAGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1440s21c1
Sequence:CCGGTGTCTCACTGTACGGTTTAATCTCGAGATTAAACCGTACAGTGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1095s21c1
Sequence:CCGGTGGCTGCTAGTGACCTCTTTGCTCGAGCAAAGAGGTCACTAGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-770s21c1
Sequence:GTACCGGGGTTGACAGATGCAAGGAATCCTCGAGGATTCCTTGCATCTGTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-903s21c1
Sequence:GTACCGGGTTCCTCGAAGCGAGTGCAAACTCGAGTTTGCACTCGCTTCGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016322
VALIDATED
RAB14 MISSION shRNA shRNA Plasmid DNA
RAB14, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-595s1c1
Sequence:CCGGGAAGCCAAACAGTTTGCTGAACTCGAGTTCAGCAAACTGTTTGGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-392s1c1
Sequence:CCGGAGGAGCGATTTAGGGCTGTTACTCGAGTAACAGCCCTAAATCGCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016322.2-505s1c1
Sequence:CCGGGATGCAAGGAATCTCACCAATCTCGAGATTGGTGAGATTCCTTGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-317s1c1
Sequence:CCGGGTGTTGAATTTGGTACAAGAACTCGAGTTCTTGTACCAAATTCAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-304s1c1
Sequence:CCGGCCTCACACAATTGGTGTTGAACTCGAGTTCAACACCAATTGTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-794s21c1
Sequence:GTACCGGCCAATCCAAATACTGTAATAACTCGAGTTATTACAGTATTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-1016s21c1
Sequence:GTACCGGAGTCTGGTGTACAACACAAACCTCGAGGTTTGTGTTGTACACCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-819s21c1
Sequence:CCGGCATAGGAAATAAAGCAGATTTCTCGAGAAATCTGCTTTATTTCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-735s21c1
Sequence:CCGGCACTAGAAGAAGTACATATAACTCGAGTTATATGTACTTCTTCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-710s21c1
Sequence:CCGGCGGGAGCTCTTATGGTCTATGCTCGAGCATAGACCATAAGAGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1440s21c1
Sequence:CCGGTGTCTCACTGTACGGTTTAATCTCGAGATTAAACCGTACAGTGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1095s21c1
Sequence:CCGGTGGCTGCTAGTGACCTCTTTGCTCGAGCAAAGAGGTCACTAGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-770s21c1
Sequence:GTACCGGGGTTGACAGATGCAAGGAATCCTCGAGGATTCCTTGCATCTGTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-903s21c1
Sequence:GTACCGGGTTCCTCGAAGCGAGTGCAAACTCGAGTTTGCACTCGCTTCGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016322
VALIDATED
RAB14 MISSION shRNA Lentiviral Transduction Particles
RAB14, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-595s1c1
Sequence:CCGGGAAGCCAAACAGTTTGCTGAACTCGAGTTCAGCAAACTGTTTGGCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-392s1c1
Sequence:CCGGAGGAGCGATTTAGGGCTGTTACTCGAGTAACAGCCCTAAATCGCTCCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016322.2-505s1c1
Sequence:CCGGGATGCAAGGAATCTCACCAATCTCGAGATTGGTGAGATTCCTTGCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016322.2-317s1c1
Sequence:CCGGGTGTTGAATTTGGTACAAGAACTCGAGTTCTTGTACCAAATTCAACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016322.2-304s1c1
Sequence:CCGGCCTCACACAATTGGTGTTGAACTCGAGTTCAACACCAATTGTGTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-794s21c1
Sequence:GTACCGGCCAATCCAAATACTGTAATAACTCGAGTTATTACAGTATTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-1016s21c1
Sequence:GTACCGGAGTCTGGTGTACAACACAAACCTCGAGGTTTGTGTTGTACACCAGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-819s21c1
Sequence:CCGGCATAGGAAATAAAGCAGATTTCTCGAGAAATCTGCTTTATTTCCTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-735s21c1
Sequence:CCGGCACTAGAAGAAGTACATATAACTCGAGTTATATGTACTTCTTCTAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-710s21c1
Sequence:CCGGCGGGAGCTCTTATGGTCTATGCTCGAGCATAGACCATAAGAGCTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1440s21c1
Sequence:CCGGTGTCTCACTGTACGGTTTAATCTCGAGATTAAACCGTACAGTGAGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016322.3-1095s21c1
Sequence:CCGGTGGCTGCTAGTGACCTCTTTGCTCGAGCAAAGAGGTCACTAGCAGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-770s21c1
Sequence:GTACCGGGGTTGACAGATGCAAGGAATCCTCGAGGATTCCTTGCATCTGTCAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016322.3-903s21c1
Sequence:GTACCGGGTTCCTCGAAGCGAGTGCAAACTCGAGTTTGCACTCGCTTCGAGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)