EMAIL THIS PAGE TO A FRIEND

RAB19

RAB19, member RAS oncogene family

48 Gene Product Result for
Synonyms: RAB19B
UniProtKB ID: A4D1S5, A4D1S6, B2RTS6, B5MDR2, Q9UL27
Gene ID:
Mouse(19331) RAB19, member RAS oncogene family
Rat(500088) RAB19, member RAS oncogene family
fruit fly(38930) CG7062 gene product from transcript CG7062-RB
domestic cat(101091859) RAB19, member RAS oncogene family
dog(482767) RAB19, member RAS oncogene family
chicken(418113) RAB19, member RAS oncogene family
naked mole-rat(101700783) RAB19, member RAS oncogene family
domestic guinea pig(100722841) RAB19, member RAS oncogene family
cow(506911) RAB19, member RAS oncogene family
sheep(101106677) RAB19, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008749 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008749 Rosetta Predictions human pricing
NM_001024326 Rosetta Predictions rat pricing
NM_011226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212021 predicted 274
2 SASI_Hs01_00212022 predicted 495
3 SASI_Hs02_00305559 predicted 492
4 SASI_Hs01_00212023 predicted 444
5 SASI_Hs02_00305560 predicted 455
6 SASI_Hs01_00212025 predicted 464
7 SASI_Hs01_00212026 predicted 198
8 SASI_Hs02_00305561 predicted 467
9 SASI_Hs01_00212028 predicted 234
10 SASI_Hs01_00212030 predicted 202
11 SASI_Hs01_00212024 predicted 461
12 SASI_Hs01_00212027 predicted 223
13 SASI_Hs01_00212029 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077505 predicted 354
2 SASI_Rn01_00077506 predicted 640
3 SASI_Rn01_00077507 predicted 601
4 SASI_Rn01_00077509 predicted 619
5 SASI_Rn01_00077510 predicted 654
6 SASI_Rn01_00077511 predicted 830
7 SASI_Rn01_00077512 predicted 1054
8 SASI_Rn01_00077513 predicted 425
9 SASI_Rn01_00077514 predicted 476
10 SASI_Rn02_00202543 predicted 1061
11 SASI_Rn01_00077508 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143870 predicted 777
2 SASI_Mm02_00320186 predicted 731
3 SASI_Mm01_00143871 predicted 1024
4 SASI_Mm01_00143872 predicted 324
5 SASI_Mm01_00143873 predicted 584
6 SASI_Mm01_00143874 predicted 364
7 SASI_Mm01_00143875 predicted 617
8 SASI_Mm01_00143876 predicted 909
9 SASI_Mm01_00143877 predicted 921
10 SASI_Mm01_00143878 predicted 602
11 SASI_Mm01_00143879 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011226
RAB19 MISSION shRNA Bacterial Glycerol Stock
RAB19, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-366s21c1
Sequence:GTACCGGACGCAGCTATCATCGCTTATGCTCGAGCATAAGCGATGATAGCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-270s21c1
Sequence:GTACCGGTCGAGATAGACGGCAAGAAAGCTCGAGCTTTCTTGCCGTCTATCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-613s21c1
Sequence:GTACCGGGCTCATGGCGAAGGAGTTAATCTCGAGATTAACTCCTTCGCCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011226.1-864s1c1
Sequence:CCGGGCCCTCAAGGACTCCATTAAACTCGAGTTTAATGGAGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-368s1c1
Sequence:CCGGGCAGCTATCATCGCTTATGATCTCGAGATCATAAGCGATGATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-199s1c1
Sequence:CCGGGCATTTCAAATCTGGAGTCTACTCGAGTAGACTCCAGATTTGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-123s1c1
Sequence:CCGGCAGATGAGAATGTGGACTATTCTCGAGAATAGTCCACATTCTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-365s1c1
Sequence:CCGGCACGCAGCTATCATCGCTTATCTCGAGATAAGCGATGATAGCTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011226
RAB19 MISSION shRNA shRNA Plasmid DNA
RAB19, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-366s21c1
Sequence:GTACCGGACGCAGCTATCATCGCTTATGCTCGAGCATAAGCGATGATAGCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-270s21c1
Sequence:GTACCGGTCGAGATAGACGGCAAGAAAGCTCGAGCTTTCTTGCCGTCTATCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-613s21c1
Sequence:GTACCGGGCTCATGGCGAAGGAGTTAATCTCGAGATTAACTCCTTCGCCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011226.1-864s1c1
Sequence:CCGGGCCCTCAAGGACTCCATTAAACTCGAGTTTAATGGAGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-368s1c1
Sequence:CCGGGCAGCTATCATCGCTTATGATCTCGAGATCATAAGCGATGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-199s1c1
Sequence:CCGGGCATTTCAAATCTGGAGTCTACTCGAGTAGACTCCAGATTTGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-123s1c1
Sequence:CCGGCAGATGAGAATGTGGACTATTCTCGAGAATAGTCCACATTCTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-365s1c1
Sequence:CCGGCACGCAGCTATCATCGCTTATCTCGAGATAAGCGATGATAGCTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011226
RAB19 MISSION shRNA Lentiviral Transduction Particles
RAB19, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-366s21c1
Sequence:GTACCGGACGCAGCTATCATCGCTTATGCTCGAGCATAAGCGATGATAGCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-270s21c1
Sequence:GTACCGGTCGAGATAGACGGCAAGAAAGCTCGAGCTTTCTTGCCGTCTATCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011226.1-613s21c1
Sequence:GTACCGGGCTCATGGCGAAGGAGTTAATCTCGAGATTAACTCCTTCGCCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011226.1-864s1c1
Sequence:CCGGGCCCTCAAGGACTCCATTAAACTCGAGTTTAATGGAGTCCTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-368s1c1
Sequence:CCGGGCAGCTATCATCGCTTATGATCTCGAGATCATAAGCGATGATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-199s1c1
Sequence:CCGGGCATTTCAAATCTGGAGTCTACTCGAGTAGACTCCAGATTTGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-123s1c1
Sequence:CCGGCAGATGAGAATGTGGACTATTCTCGAGAATAGTCCACATTCTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011226.1-365s1c1
Sequence:CCGGCACGCAGCTATCATCGCTTATCTCGAGATAAGCGATGATAGCTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008749
RAB19 MISSION shRNA Bacterial Glycerol Stock
RAB19, member RAS oncogene family
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-587s21c1
Sequence:GTACCGGATAAATGTGACCTCTGGGAAACTCGAGTTTCCCAGAGGTCACATTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-683s21c1
Sequence:GTACCGGCCAAGGAGTCAAAGAACATAGCTCGAGCTATGTTCTTTGACTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-229s21c1
Sequence:GTACCGGGATGAGAACTTTGACTATTTGCTCGAGCAAATAGTCAAAGTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-476s21c1
Sequence:GTACCGGCCATCATCGCCTATGACCTCACTCGAGTGAGGTCATAGGCGATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-316s21c1
Sequence:GTACCGGGGAGTCTACACTGAGACACAGCTCGAGCTGTGTCTCAGTGTAGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-524s21c1
Sequence:GTACCGGCTCACTGGATTCATGAGATAGCTCGAGCTATCTCATGAATCCAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-341s21c1
Sequence:GTACCGGACACGATTGGAGTGGACTTTACTCGAGTAAAGTCCACTCCAATCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-555s21c1
Sequence:GTACCGGAGCTGCAAATGTGGTCATTATCTCGAGATAATGACCACATTTGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-288s21c1
Sequence:GTACCGGGACGTGTGTGGTGCAGCATTTCTCGAGAAATGCTGCACCACACACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008749
RAB19 MISSION shRNA shRNA Plasmid DNA
RAB19, member RAS oncogene family
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-587s21c1
Sequence:GTACCGGATAAATGTGACCTCTGGGAAACTCGAGTTTCCCAGAGGTCACATTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-683s21c1
Sequence:GTACCGGCCAAGGAGTCAAAGAACATAGCTCGAGCTATGTTCTTTGACTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-229s21c1
Sequence:GTACCGGGATGAGAACTTTGACTATTTGCTCGAGCAAATAGTCAAAGTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-476s21c1
Sequence:GTACCGGCCATCATCGCCTATGACCTCACTCGAGTGAGGTCATAGGCGATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-316s21c1
Sequence:GTACCGGGGAGTCTACACTGAGACACAGCTCGAGCTGTGTCTCAGTGTAGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-524s21c1
Sequence:GTACCGGCTCACTGGATTCATGAGATAGCTCGAGCTATCTCATGAATCCAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-341s21c1
Sequence:GTACCGGACACGATTGGAGTGGACTTTACTCGAGTAAAGTCCACTCCAATCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-555s21c1
Sequence:GTACCGGAGCTGCAAATGTGGTCATTATCTCGAGATAATGACCACATTTGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-288s21c1
Sequence:GTACCGGGACGTGTGTGGTGCAGCATTTCTCGAGAAATGCTGCACCACACACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008749
RAB19 MISSION shRNA Lentiviral Transduction Particles
RAB19, member RAS oncogene family
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-587s21c1
Sequence:GTACCGGATAAATGTGACCTCTGGGAAACTCGAGTTTCCCAGAGGTCACATTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-683s21c1
Sequence:GTACCGGCCAAGGAGTCAAAGAACATAGCTCGAGCTATGTTCTTTGACTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-229s21c1
Sequence:GTACCGGGATGAGAACTTTGACTATTTGCTCGAGCAAATAGTCAAAGTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-476s21c1
Sequence:GTACCGGCCATCATCGCCTATGACCTCACTCGAGTGAGGTCATAGGCGATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-316s21c1
Sequence:GTACCGGGGAGTCTACACTGAGACACAGCTCGAGCTGTGTCTCAGTGTAGACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-524s21c1
Sequence:GTACCGGCTCACTGGATTCATGAGATAGCTCGAGCTATCTCATGAATCCAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-341s21c1
Sequence:GTACCGGACACGATTGGAGTGGACTTTACTCGAGTAAAGTCCACTCCAATCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-555s21c1
Sequence:GTACCGGAGCTGCAAATGTGGTCATTATCTCGAGATAATGACCACATTTGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008749.2-288s21c1
Sequence:GTACCGGGACGTGTGTGGTGCAGCATTTCTCGAGAAATGCTGCACCACACACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376681
RAB19 MISSION shRNA Bacterial Glycerol Stock
RAB19, member RAS oncogene family
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-197s1c1
Sequence:CCGGTGAAGAACAGTTCGGCCAGTACTCGAGTACTGGCCGAACTGTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-105s1c1
Sequence:CCGGGCATTTCAAGTCTGGAGTCTACTCGAGTAGACTCCAGACTTGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-28s1c1
Sequence:CCGGGCAGATGAGAACTTTGACTATCTCGAGATAGTCAAAGTTCTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-208s1c1
Sequence:CCGGTCGGCCAGTATTATCACCTTTCTCGAGAAAGGTGATAATACTGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-466s1c1
Sequence:CCGGCCTCACTGGATTCATGAGATACTCGAGTATCTCATGAATCCAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376681
RAB19 MISSION shRNA shRNA Plasmid DNA
RAB19, member RAS oncogene family
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-197s1c1
Sequence:CCGGTGAAGAACAGTTCGGCCAGTACTCGAGTACTGGCCGAACTGTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-105s1c1
Sequence:CCGGGCATTTCAAGTCTGGAGTCTACTCGAGTAGACTCCAGACTTGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-28s1c1
Sequence:CCGGGCAGATGAGAACTTTGACTATCTCGAGATAGTCAAAGTTCTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-208s1c1
Sequence:CCGGTCGGCCAGTATTATCACCTTTCTCGAGAAAGGTGATAATACTGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-466s1c1
Sequence:CCGGCCTCACTGGATTCATGAGATACTCGAGTATCTCATGAATCCAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376681
RAB19 MISSION shRNA Lentiviral Transduction Particles
RAB19, member RAS oncogene family
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-197s1c1
Sequence:CCGGTGAAGAACAGTTCGGCCAGTACTCGAGTACTGGCCGAACTGTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-105s1c1
Sequence:CCGGGCATTTCAAGTCTGGAGTCTACTCGAGTAGACTCCAGACTTGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-28s1c1
Sequence:CCGGGCAGATGAGAACTTTGACTATCTCGAGATAGTCAAAGTTCTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-208s1c1
Sequence:CCGGTCGGCCAGTATTATCACCTTTCTCGAGAAAGGTGATAATACTGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376681.1-466s1c1
Sequence:CCGGCCTCACTGGATTCATGAGATACTCGAGTATCTCATGAATCCAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)