EMAIL THIS PAGE TO A FRIEND

RAB21

RAB21, member RAS oncogene family

153 Gene Product Result for
UniProtKB ID: Q9UL25, Q14466, Q569H3
Gene ID:
Human(23011) Summary: RAB21 belongs to the RAB family of small GTP-binding proteins that regulate intracellular vesicle targeting (Opdam et al., 2000 [PubMed 10887961]
Mouse(216344) RAB21, member RAS oncogene family
Rat(299799) RAB21, member RAS oncogene family
cow(507488) RAB21, member RAS oncogene family
sheep(100302077) RAB21, member RAS oncogene family
naked mole-rat(101722646) RAB21, member RAS oncogene family
domestic guinea pig(100718613) RAB21, member RAS oncogene family
fruit fly(3355163) CG17515 gene product from transcript CG17515-RD
domestic cat(101081478) RAB21, member RAS oncogene family
dog(100683312) RAB21, member RAS oncogene family
chicken(771383) RAB21, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014999 Rosetta Predictions human pricing
NM_001004238 Rosetta Predictions rat pricing
NM_024454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065825 predicted 853
2 SASI_Hs01_00065827 predicted 515
3 SASI_Hs01_00065829 predicted 756
4 SASI_Hs01_00065830 predicted 721
5 SASI_Hs01_00065832 predicted 662
6 SASI_Hs02_00346765 predicted 763
7 SASI_Hs01_00065833 predicted 760
8 SASI_Hs02_00346766 predicted 826
9 SASI_Hs02_00346767 predicted 615
10 SASI_Hs02_00346768 predicted 549
11 SASI_Hs01_00065826 predicted 629
12 SASI_Hs01_00065828 predicted 636
13 SASI_Hs01_00065831 predicted 610
14 SASI_Hs01_00065834 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198244 predicted 969
2 SASI_Rn01_00036130 predicted 980
3 SASI_Rn01_00036131 predicted 478
4 SASI_Rn02_00198245 predicted 677
5 SASI_Rn01_00036132 predicted 998
6 SASI_Rn01_00036133 predicted 586
7 SASI_Rn02_00198246 predicted 1027
8 SASI_Rn01_00036135 predicted 977
9 SASI_Rn01_00036137 predicted 715
10 SASI_Rn02_00198247 predicted 1025
11 SASI_Rn01_00036134 predicted 673
12 SASI_Rn01_00036136 predicted 484
13 SASI_Rn01_00036138 predicted 478
14 SASI_Rn01_00036139 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029670 predicted 1034
2 SASI_Mm01_00029671 predicted 1061
3 SASI_Mm01_00029672 predicted 1003
4 SASI_Mm01_00029673 predicted 748
5 SASI_Mm01_00029674 predicted 612
6 SASI_Mm01_00029675 predicted 501
7 SASI_Mm01_00029676 predicted 978
8 SASI_Mm01_00029677 predicted 658
9 SASI_Mm01_00029678 predicted 1001
10 SASI_Mm01_00029679 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014999
VALIDATED
RAB21 MISSION shRNA Bacterial Glycerol Stock
RAB21, member RAS oncogene family
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-549s21c1
Sequence:GTACCGGTGACATAACAGATGAAGATTCCTCGAGGAATCTTCATCTGTTATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014999.2-1106s21c1
Sequence:GTACCGGGTGACCAGAGAATTGGCATTTCTCGAGAAATGCCAATTCTCTGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-521s21c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-859s21c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-408s21c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-372s21c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-925s21c1
Sequence:GTACCGGGGATAACTGTTCACGCCTAAGCTCGAGCTTAGGCGTGAACAGTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-524s1c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-411s1c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-862s1c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014999.1-481s1c1
Sequence:CCGGGCAGGTCAAGAGAGATTCCATCTCGAGATGGAATCTCTCTTGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-375s1c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014999
VALIDATED
RAB21 MISSION shRNA shRNA Plasmid DNA
RAB21, member RAS oncogene family
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-549s21c1
Sequence:GTACCGGTGACATAACAGATGAAGATTCCTCGAGGAATCTTCATCTGTTATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014999.2-1106s21c1
Sequence:GTACCGGGTGACCAGAGAATTGGCATTTCTCGAGAAATGCCAATTCTCTGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-521s21c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-859s21c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-408s21c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-372s21c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-925s21c1
Sequence:GTACCGGGGATAACTGTTCACGCCTAAGCTCGAGCTTAGGCGTGAACAGTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-524s1c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-411s1c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-862s1c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014999.1-481s1c1
Sequence:CCGGGCAGGTCAAGAGAGATTCCATCTCGAGATGGAATCTCTCTTGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-375s1c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014999
VALIDATED
RAB21 MISSION shRNA Lentiviral Transduction Particles
RAB21, member RAS oncogene family
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-549s21c1
Sequence:GTACCGGTGACATAACAGATGAAGATTCCTCGAGGAATCTTCATCTGTTATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014999.2-1106s21c1
Sequence:GTACCGGGTGACCAGAGAATTGGCATTTCTCGAGAAATGCCAATTCTCTGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-521s21c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-859s21c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-408s21c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014999.2-372s21c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014999.2-925s21c1
Sequence:GTACCGGGGATAACTGTTCACGCCTAAGCTCGAGCTTAGGCGTGAACAGTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-524s1c1
Sequence:CCGGGAGATTCAAATGGAGCGATTTCTCGAGAAATCGCTCCATTTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-411s1c1
Sequence:CCGGGCAGGCATCATTCTTAACAAACTCGAGTTTGTTAAGAATGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-862s1c1
Sequence:CCGGCGAGGTGTACAGATTATTGATCTCGAGATCAATAATCTGTACACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014999.1-481s1c1
Sequence:CCGGGCAGGTCAAGAGAGATTCCATCTCGAGATGGAATCTCTCTTGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014999.1-375s1c1
Sequence:CCGGCGAGAACAAGTTTAACGACAACTCGAGTTGTCGTTAAACTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024454
VALIDATED
RAB21 MISSION shRNA Bacterial Glycerol Stock
RAB21, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-395s21c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-493s21c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024454.1-1192s21c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-710s21c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-726s21c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024454.1-1192s1c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-726s1c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-395s1c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-710s1c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-493s1c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024454
VALIDATED
RAB21 MISSION shRNA shRNA Plasmid DNA
RAB21, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-395s21c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-493s21c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024454.1-1192s21c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-710s21c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-726s21c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024454.1-1192s1c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-726s1c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-395s1c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-710s1c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-493s1c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024454
VALIDATED
RAB21 MISSION shRNA Lentiviral Transduction Particles
RAB21, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-395s21c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-493s21c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024454.1-1192s21c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-710s21c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024454.1-726s21c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024454.1-1192s1c1
Sequence:CCGGCCTACTTAAAGGCTTCATTTACTCGAGTAAATGAAGCCTTTAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-726s1c1
Sequence:CCGGGCTAAACAGAACAAAGGCATTCTCGAGAATGCCTTTGTTCTGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-395s1c1
Sequence:CCGGGCAGGCATCTTTCTTAACAAACTCGAGTTTGTTAAGAAAGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024454.1-710s1c1
Sequence:CCGGGCATTACCATACTTCCGCTAACTCGAGTTAGCGGAAGTATGGTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024454.1-493s1c1
Sequence:CCGGGCCCAATTTACTACCGAGATTCTCGAGAATCTCGGTAGTAAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)