EMAIL THIS PAGE TO A FRIEND

RAB22A

RAB22A, member RAS oncogene family

212 Gene Product Result for
UniProtKB ID: Q9UL26, B3KR86, E1P605, Q8TF12, Q9H4E6
Gene ID:
Human(57403) Summary: The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Mouse(19334) RAB22A, member RAS oncogene family
Rat(366265) RAB22A, member RAS oncogene family
Zebrafish(100001531) RAB22A, member RAS oncogene family
domestic cat(101092426) RAB22A, member RAS oncogene family
dog(403864) RAB22A, member RAS oncogene family
chicken(419318) RAB22A, member RAS oncogene family
domestic guinea pig(100731614) RAB22A, member RAS oncogene family
naked mole-rat(101711368) RAB22A, member RAS oncogene family
cow(617385) RAB22A, member RAS oncogene family
sheep(101116850) RAB22A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020673 siRNAs that have been validated in the lab human pricing
NM_001108966 Rosetta Predictions rat pricing
NM_024436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020673 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224606 validated 497
2 SASI_Hs01_00224607 predicted 1103
3 SASI_Hs01_00224609 predicted 862
4 SASI_Hs01_00224612 predicted 578
5 SASI_Hs02_00353659 predicted 978
6 SASI_Hs02_00353660 predicted 599
7 SASI_Hs01_00224615 predicted 1024
8 SASI_Hs02_00353661 predicted 496
9 SASI_Hs02_00353662 predicted 958
10 SASI_Hs02_00353663 predicted 869
11 SASI_Hs01_00224608 predicted 1036
12 SASI_Hs01_00224610 predicted 722
13 SASI_Hs01_00224611 predicted 670
14 SASI_Hs01_00224613 predicted 1028
15 SASI_Hs01_00224614 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243844 predicted 559
2 SASI_Rn02_00243845 predicted 319
3 SASI_Rn02_00243846 predicted 1090
4 SASI_Rn02_00243847 predicted 535
5 SASI_Rn02_00243848 predicted 246
6 SASI_Rn02_00243849 predicted 1080
7 SASI_Rn02_00243850 predicted 892
8 SASI_Rn02_00243851 predicted 328
9 SASI_Rn02_00243852 predicted 320
10 SASI_Rn02_00243853 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090243 predicted 1091
2 SASI_Mm01_00090244 predicted 609
3 SASI_Mm01_00090245 predicted 673
4 SASI_Mm01_00090246 predicted 459
5 SASI_Mm01_00090242 predicted 493
6 SASI_Mm02_00327757 predicted 726
7 SASI_Mm01_00090247 predicted 661
8 SASI_Mm01_00090248 predicted 1034
9 SASI_Mm01_00090250 predicted 1142
10 SASI_Mm02_00327758 predicted 581
11 SASI_Mm01_00090249 predicted 719
12 SASI_Mm01_00090251 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024436
VALIDATED
RAB22A MISSION shRNA Bacterial Glycerol Stock
RAB22A, member RAS oncogene family
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024436.1-3139s1c1
Sequence:CCGGGCCGGTGTGTATTGATCGTTTCTCGAGAAACGATCAATACACACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-341s1c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-431s1c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-655s1c1
Sequence:CCGGCGCAGATTCCATTCATGCCATCTCGAGATGGCATGAATGGAATCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024436.1-593s1c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1230s21c1
Sequence:GTACCGGTGTCAGAGTCGTATCAGTAAGCTCGAGCTTACTGATACGACTCTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1097s21c1
Sequence:CCGGATGGATGGTAGGATTGAATTGCTCGAGCAATTCAATCCTACCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024436.3-445s21c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-355s21c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-607s21c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-919s21c1
Sequence:GTACCGGGACGCCACCTCATGCTCTTTACTCGAGTAAAGAGCATGAGGTGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024436
VALIDATED
RAB22A MISSION shRNA shRNA Plasmid DNA
RAB22A, member RAS oncogene family
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024436.1-3139s1c1
Sequence:CCGGGCCGGTGTGTATTGATCGTTTCTCGAGAAACGATCAATACACACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-341s1c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-431s1c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-655s1c1
Sequence:CCGGCGCAGATTCCATTCATGCCATCTCGAGATGGCATGAATGGAATCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024436.1-593s1c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1230s21c1
Sequence:GTACCGGTGTCAGAGTCGTATCAGTAAGCTCGAGCTTACTGATACGACTCTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1097s21c1
Sequence:CCGGATGGATGGTAGGATTGAATTGCTCGAGCAATTCAATCCTACCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024436.3-445s21c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-355s21c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-607s21c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-919s21c1
Sequence:GTACCGGGACGCCACCTCATGCTCTTTACTCGAGTAAAGAGCATGAGGTGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024436
VALIDATED
RAB22A MISSION shRNA Lentiviral Transduction Particles
RAB22A, member RAS oncogene family
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024436.1-3139s1c1
Sequence:CCGGGCCGGTGTGTATTGATCGTTTCTCGAGAAACGATCAATACACACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-341s1c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-431s1c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024436.1-655s1c1
Sequence:CCGGCGCAGATTCCATTCATGCCATCTCGAGATGGCATGAATGGAATCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024436.1-593s1c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1230s21c1
Sequence:GTACCGGTGTCAGAGTCGTATCAGTAAGCTCGAGCTTACTGATACGACTCTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-1097s21c1
Sequence:CCGGATGGATGGTAGGATTGAATTGCTCGAGCAATTCAATCCTACCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024436.3-445s21c1
Sequence:CCGGGCTGGACAAGAACGATTTCGTCTCGAGACGAAATCGTTCTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-355s21c1
Sequence:CCGGCCGAATATCAATCCAACCATACTCGAGTATGGTTGGATTGATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-607s21c1
Sequence:CCGGGCAGGGAACAAGTGCGATCTTCTCGAGAAGATCGCACTTGTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024436.3-919s21c1
Sequence:GTACCGGGACGCCACCTCATGCTCTTTACTCGAGTAAAGAGCATGAGGTGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020673
VALIDATED
RAB22A MISSION shRNA Bacterial Glycerol Stock
RAB22A, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-500s1c1
Sequence:CCGGGCAGCTATAATCGTTTATGATCTCGAGATCATAAACGATTATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-715s1c1
Sequence:CCGGCGCGATAAACATAAATGAACTCTCGAGAGTTCATTTATGTTTATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020673.2-303s1c1
Sequence:CCGGCAGGTGTAGGTAAATCGAGTACTCGAGTACTCGATTTACCTACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-452s1c1
Sequence:CCGGCAAGAACGATTTCGTGCCTTACTCGAGTAAGGCACGAAATCGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-356s1c1
Sequence:CCGGCCAAACATCAACCCAACAATACTCGAGTATTGTTGGGTTGATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-619s21c1
Sequence:GTACCGGATGTGATCTTATCGATGTAAGCTCGAGCTTACATCGATAAGATCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-357s21c1
Sequence:GTACCGGCAAACATCAACCCAACAATAGCTCGAGCTATTGTTGGGTTGATGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020673.2-8213s21c1
Sequence:CCGGGCCGCTTTGTAGCACTATTATCTCGAGATAATAGTGCTACAAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-490s21c1
Sequence:CCGGAGGGTCGGCTGCAGCTATAATCTCGAGATTATAGCTGCAGCCGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-305s21c1
Sequence:CCGGGGTGTAGGTAAATCGAGTATTCTCGAGAATACTCGATTTACCTACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020673
VALIDATED
RAB22A MISSION shRNA shRNA Plasmid DNA
RAB22A, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-500s1c1
Sequence:CCGGGCAGCTATAATCGTTTATGATCTCGAGATCATAAACGATTATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-715s1c1
Sequence:CCGGCGCGATAAACATAAATGAACTCTCGAGAGTTCATTTATGTTTATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020673.2-303s1c1
Sequence:CCGGCAGGTGTAGGTAAATCGAGTACTCGAGTACTCGATTTACCTACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-452s1c1
Sequence:CCGGCAAGAACGATTTCGTGCCTTACTCGAGTAAGGCACGAAATCGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-356s1c1
Sequence:CCGGCCAAACATCAACCCAACAATACTCGAGTATTGTTGGGTTGATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-619s21c1
Sequence:GTACCGGATGTGATCTTATCGATGTAAGCTCGAGCTTACATCGATAAGATCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-357s21c1
Sequence:GTACCGGCAAACATCAACCCAACAATAGCTCGAGCTATTGTTGGGTTGATGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020673.2-8213s21c1
Sequence:CCGGGCCGCTTTGTAGCACTATTATCTCGAGATAATAGTGCTACAAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-490s21c1
Sequence:CCGGAGGGTCGGCTGCAGCTATAATCTCGAGATTATAGCTGCAGCCGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-305s21c1
Sequence:CCGGGGTGTAGGTAAATCGAGTATTCTCGAGAATACTCGATTTACCTACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020673
VALIDATED
RAB22A MISSION shRNA Lentiviral Transduction Particles
RAB22A, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-500s1c1
Sequence:CCGGGCAGCTATAATCGTTTATGATCTCGAGATCATAAACGATTATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-715s1c1
Sequence:CCGGCGCGATAAACATAAATGAACTCTCGAGAGTTCATTTATGTTTATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020673.2-303s1c1
Sequence:CCGGCAGGTGTAGGTAAATCGAGTACTCGAGTACTCGATTTACCTACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-452s1c1
Sequence:CCGGCAAGAACGATTTCGTGCCTTACTCGAGTAAGGCACGAAATCGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020673.2-356s1c1
Sequence:CCGGCCAAACATCAACCCAACAATACTCGAGTATTGTTGGGTTGATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-619s21c1
Sequence:GTACCGGATGTGATCTTATCGATGTAAGCTCGAGCTTACATCGATAAGATCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-357s21c1
Sequence:GTACCGGCAAACATCAACCCAACAATAGCTCGAGCTATTGTTGGGTTGATGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020673.2-8213s21c1
Sequence:CCGGGCCGCTTTGTAGCACTATTATCTCGAGATAATAGTGCTACAAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-490s21c1
Sequence:CCGGAGGGTCGGCTGCAGCTATAATCTCGAGATTATAGCTGCAGCCGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020673.2-305s21c1
Sequence:CCGGGGTGTAGGTAAATCGAGTATTCTCGAGAATACTCGATTTACCTACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)