EMAIL THIS PAGE TO A FRIEND

RAB23

RAB23, member RAS oncogene family

81 Gene Product Result for
Synonyms: HSPC137
UniProtKB ID: Q9ULC3, B2R9I5, Q68DJ6, Q8NI06, Q9P023
Gene ID:
Human(51715) Summary: This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(19335) RAB23, member RAS oncogene family
Rat(367242) RAB23, member RAS oncogene family
cow(618588) RAB23, member RAS oncogene family
sheep(101106290) RAB23, member RAS oncogene family
naked mole-rat(101718781) RAB23, member RAS oncogene family
domestic guinea pig(100731259) RAB23, member RAS oncogene family
fruit fly(40701) CG2108 gene product from transcript CG2108-RA
chicken(421879) RAB23, member RAS oncogene family
dog(481854) RAB23, member RAS oncogene family
Zebrafish(553778) RAB23, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101693 Anti-RAB23 (31-45) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300189 Anti-RAB23 (C-term) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2500851 Anti-RAB23 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, rat, mouse
ELISA, western blot pricing
SAB1407515 Anti-RAB23 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1400570 Anti-RAB23 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
HPA029135 Anti-RAB23 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA029136 Anti-RAB23 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB2107222 Anti-RAB23 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit, mouse
ELISA, western blot pricing
SAB2105066 Anti-RAB23, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, rat, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016277 Rosetta Predictions human pricing
NM_183227 Rosetta Predictions human pricing
NM_001109005 Rosetta Predictions rat pricing
NM_008999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063130 predicted 925
2 SASI_Hs01_00063131 predicted 1168
3 SASI_Hs01_00063133 predicted 1207
4 SASI_Hs01_00063134 predicted 1082
5 SASI_Hs01_00063135 predicted 1042
6 SASI_Hs01_00063136 predicted 819
7 SASI_Hs01_00063137 predicted 1163
8 SASI_Hs01_00063138 predicted 1229
9 SASI_Hs01_00063139 predicted 788
10 SASI_Hs02_00349191 predicted 1237
11 SASI_Hs01_00063132 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224113 predicted 510
2 SASI_Hs01_00224114 predicted 756
3 SASI_Hs01_00224116 predicted 793
4 SASI_Hs01_00224117 predicted 671
5 SASI_Hs01_00224118 predicted 623
6 SASI_Hs01_00224119 predicted 407
7 SASI_Hs01_00224120 predicted 745
8 SASI_Hs01_00224121 predicted 812
9 SASI_Hs01_00224122 predicted 369
10 SASI_Hs02_00371225 predicted 830
11 SASI_Hs01_00224115 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244234 predicted 886
2 SASI_Rn02_00244235 predicted 977
3 SASI_Rn02_00244236 predicted 624
4 SASI_Rn02_00244237 predicted 1153
5 SASI_Rn02_00244238 predicted 771
6 SASI_Rn02_00244239 predicted 552
7 SASI_Rn02_00244240 predicted 700
8 SASI_Rn02_00244241 predicted 979
9 SASI_Rn02_00244242 predicted 805
10 SASI_Rn02_00244243 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042395 predicted 803
2 SASI_Mm01_00042396 predicted 988
3 SASI_Mm02_00315116 predicted 483
4 SASI_Mm01_00042397 predicted 1072
5 SASI_Mm01_00042398 predicted 1171
6 SASI_Mm01_00042399 predicted 1025
7 SASI_Mm01_00042400 predicted 974
8 SASI_Mm01_00042401 predicted 1237
9 SASI_Mm01_00042402 predicted 1067
10 SASI_Mm01_00042403 predicted 997
11 SASI_Mm01_00042404 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016277
VALIDATED
RAB23 MISSION shRNA Bacterial Glycerol Stock
RAB23, member RAS oncogene family
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-823s21c1
Sequence:GTACCGGAGGAGGAATTTGATGCAATTACTCGAGTAATTGCATCAAATTCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-986s21c1
Sequence:GTACCGGGATTGATCTTCTGGATGATTCCTCGAGGAATCATCCAGAAGATCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016277.3-1362s21c1
Sequence:GTACCGGTACATTGTGCAATGCATTAAGCTCGAGCTTAATGCATTGCACAATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-837s1c1
Sequence:CCGGGCAATTACAAAGGCCTACTATCTCGAGATAGTAGGCCTTTGTAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-1262s1c1
Sequence:CCGGCATCAATCTTAGACCCAACAACTCGAGTTGTTGGGTCTAAGATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016277.3-1172s1c1
Sequence:CCGGGCATTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-762s1c1
Sequence:CCGGGAGCGACAAATTCAAGTTAATCTCGAGATTAACTTGAATTTGTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-688s1c1
Sequence:CCGGCAAGTATGATTCAGCGATATTCTCGAGAATATCGCTGAATCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016277
VALIDATED
RAB23 MISSION shRNA shRNA Plasmid DNA
RAB23, member RAS oncogene family
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-823s21c1
Sequence:GTACCGGAGGAGGAATTTGATGCAATTACTCGAGTAATTGCATCAAATTCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-986s21c1
Sequence:GTACCGGGATTGATCTTCTGGATGATTCCTCGAGGAATCATCCAGAAGATCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016277.3-1362s21c1
Sequence:GTACCGGTACATTGTGCAATGCATTAAGCTCGAGCTTAATGCATTGCACAATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-837s1c1
Sequence:CCGGGCAATTACAAAGGCCTACTATCTCGAGATAGTAGGCCTTTGTAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-1262s1c1
Sequence:CCGGCATCAATCTTAGACCCAACAACTCGAGTTGTTGGGTCTAAGATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016277.3-1172s1c1
Sequence:CCGGGCATTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-762s1c1
Sequence:CCGGGAGCGACAAATTCAAGTTAATCTCGAGATTAACTTGAATTTGTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-688s1c1
Sequence:CCGGCAAGTATGATTCAGCGATATTCTCGAGAATATCGCTGAATCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016277
VALIDATED
RAB23 MISSION shRNA Lentiviral Transduction Particles
RAB23, member RAS oncogene family
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-823s21c1
Sequence:GTACCGGAGGAGGAATTTGATGCAATTACTCGAGTAATTGCATCAAATTCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016277.3-986s21c1
Sequence:GTACCGGGATTGATCTTCTGGATGATTCCTCGAGGAATCATCCAGAAGATCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016277.3-1362s21c1
Sequence:GTACCGGTACATTGTGCAATGCATTAAGCTCGAGCTTAATGCATTGCACAATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-837s1c1
Sequence:CCGGGCAATTACAAAGGCCTACTATCTCGAGATAGTAGGCCTTTGTAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-1262s1c1
Sequence:CCGGCATCAATCTTAGACCCAACAACTCGAGTTGTTGGGTCTAAGATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016277.3-1172s1c1
Sequence:CCGGGCATTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-762s1c1
Sequence:CCGGGAGCGACAAATTCAAGTTAATCTCGAGATTAACTTGAATTTGTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016277.3-688s1c1
Sequence:CCGGCAAGTATGATTCAGCGATATTCTCGAGAATATCGCTGAATCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008999
RAB23 MISSION shRNA Bacterial Glycerol Stock
RAB23, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-987s21c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-1077s21c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-580s21c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008999.4-1808s21c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-801s21c1
Sequence:CCGGGATCGATCTGCTGGATGATTCCTCGAGGAATCATCCAGCAGATCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008999.2-1809s1c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-1078s1c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-811s1c1
Sequence:CCGGGCTGGATGATTCATGCATCAACTCGAGTTGATGCATGAATCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-581s1c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-988s1c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008999
RAB23 MISSION shRNA shRNA Plasmid DNA
RAB23, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-987s21c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-1077s21c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-580s21c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008999.4-1808s21c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-801s21c1
Sequence:CCGGGATCGATCTGCTGGATGATTCCTCGAGGAATCATCCAGCAGATCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008999.2-1809s1c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-1078s1c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-811s1c1
Sequence:CCGGGCTGGATGATTCATGCATCAACTCGAGTTGATGCATGAATCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-581s1c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-988s1c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008999
RAB23 MISSION shRNA Lentiviral Transduction Particles
RAB23, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-987s21c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-1077s21c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-580s21c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008999.4-1808s21c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008999.4-801s21c1
Sequence:CCGGGATCGATCTGCTGGATGATTCCTCGAGGAATCATCCAGCAGATCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008999.2-1809s1c1
Sequence:CCGGGCCAAACACTACCGCTAATTTCTCGAGAAATTAGCGGTAGTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-1078s1c1
Sequence:CCGGCATCAACCTTAGACCTAACAACTCGAGTTGTTAGGTCTAAGGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-811s1c1
Sequence:CCGGGCTGGATGATTCATGCATCAACTCGAGTTGATGCATGAATCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-581s1c1
Sequence:CCGGCGACAGATTCAGGTTAACGATCTCGAGATCGTTAACCTGAATCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008999.2-988s1c1
Sequence:CCGGACACTCAAGTAGTAACAAGATCTCGAGATCTTGTTACTACTTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)