EMAIL THIS PAGE TO A FRIEND

RAB25

RAB25, member RAS oncogene family

53 Gene Product Result for
Synonyms: CATX-8 RAB11C
UniProtKB ID: P57735, Q5VYA2, Q8NG24, Q96GB1, Q9BT12
Gene ID:
Human(57111) Summary: RAB proteins, such as RAB25, are members of the RAS superfamily of small GTPases that are involved in membrane trafficking. Members of the RAB11 subfamily, including RAB25, control the return of internalized membrane-associated moieties to the cell surface (Caswell et al., 2007 [PubMed 17925226]
Mouse(53868) RAB25, member RAS oncogene family
Rat(310632) RAB25, member RAS oncogene family
cow(506482) RAB25, member RAS oncogene family
sheep(101123339) RAB25, member RAS oncogene family
naked mole-rat(101703376) RAB25, member RAS oncogene family
Domestic Rabbit(100009059) RAB25, member RAS oncogene family
domestic guinea pig(100720999) RAB25, member RAS oncogene family
chicken(100858582) RAB25, member RAS oncogene family
dog(490418) RAB25, member RAS oncogene family
domestic cat(101084416) RAB25, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020387 Rosetta Predictions human pricing
NM_001107687 Rosetta Predictions rat pricing
NM_016899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216284 predicted 441
2 SASI_Hs01_00216286 predicted 578
3 SASI_Hs01_00216287 predicted 322
4 SASI_Hs01_00216288 predicted 631
5 SASI_Hs01_00216289 predicted 232
6 SASI_Hs02_00353358 predicted 711
7 SASI_Hs01_00216290 predicted 701
8 SASI_Hs01_00216291 predicted 549
9 SASI_Hs01_00216292 predicted 307
10 SASI_Hs01_00216293 predicted 580
11 SASI_Hs01_00216285 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231285 predicted 717
2 SASI_Rn02_00231286 predicted 232
3 SASI_Rn02_00231287 predicted 532
4 SASI_Rn02_00231288 predicted 701
5 SASI_Rn02_00231289 predicted 236
6 SASI_Rn02_00231290 predicted 854
7 SASI_Rn02_00231291 predicted 572
8 SASI_Rn02_00231292 predicted 717
9 SASI_Rn02_00231293 predicted 640
10 SASI_Rn02_00231294 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161446 predicted 422
2 SASI_Mm01_00161449 predicted 677
3 SASI_Mm01_00161450 predicted 511
4 SASI_Mm01_00161452 predicted 213
5 SASI_Mm01_00161453 predicted 298
6 SASI_Mm02_00323743 predicted 335
7 SASI_Mm02_00323744 predicted 431
8 SASI_Mm01_00161454 predicted 547
9 SASI_Mm02_00323745 predicted 547
10 SASI_Mm02_00323746 predicted 702
11 SASI_Mm01_00161447 predicted 301
12 SASI_Mm01_00161448 predicted 231
13 SASI_Mm01_00161451 predicted 286
14 SASI_Mm01_00161455 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020387
VALIDATED
RAB25 MISSION shRNA Bacterial Glycerol Stock
RAB25, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-706s1c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-571s1c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-685s1c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-387s1c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020387.1-287s1c1
Sequence:CCGGAGACCAATCTACTCTCCCGATCTCGAGATCGGGAGAGTAGATTGGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-302s21c1
Sequence:GTACCGGACCAATCTACTCTCCCGATTCCTCGAGGAATCGGGAGAGTAGATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-584s21c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-931s21c1
Sequence:GTACCGGAGGACCTTTCCTTGCCCTTTGCTCGAGCAAAGGGCAAGGAAAGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-719s21c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-698s21c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-400s21c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-453s21c1
Sequence:GTACCGGCCATCACCTCGGCGTACTATCCTCGAGGATAGTACGCCGAGGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-840s21c1
Sequence:GTACCGGAGAAGAGGGCCTGTTGCATCACTCGAGTGATGCAACAGGCCCTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-540s21c1
Sequence:GTACCGGGATGGCTGAAGGAGCTCTATGCTCGAGCATAGAGCTCCTTCAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020387
VALIDATED
RAB25 MISSION shRNA shRNA Plasmid DNA
RAB25, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-706s1c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-571s1c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-685s1c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-387s1c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020387.1-287s1c1
Sequence:CCGGAGACCAATCTACTCTCCCGATCTCGAGATCGGGAGAGTAGATTGGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-302s21c1
Sequence:GTACCGGACCAATCTACTCTCCCGATTCCTCGAGGAATCGGGAGAGTAGATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-584s21c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-931s21c1
Sequence:GTACCGGAGGACCTTTCCTTGCCCTTTGCTCGAGCAAAGGGCAAGGAAAGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-719s21c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-698s21c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-400s21c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-453s21c1
Sequence:GTACCGGCCATCACCTCGGCGTACTATCCTCGAGGATAGTACGCCGAGGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-840s21c1
Sequence:GTACCGGAGAAGAGGGCCTGTTGCATCACTCGAGTGATGCAACAGGCCCTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-540s21c1
Sequence:GTACCGGGATGGCTGAAGGAGCTCTATGCTCGAGCATAGAGCTCCTTCAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020387
VALIDATED
RAB25 MISSION shRNA Lentiviral Transduction Particles
RAB25, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-706s1c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-571s1c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-685s1c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020387.1-387s1c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020387.1-287s1c1
Sequence:CCGGAGACCAATCTACTCTCCCGATCTCGAGATCGGGAGAGTAGATTGGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-302s21c1
Sequence:GTACCGGACCAATCTACTCTCCCGATTCCTCGAGGAATCGGGAGAGTAGATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-584s21c1
Sequence:CCGGGTCATGCTCGTGGGTAACAAACTCGAGTTTGTTACCCACGAGCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-931s21c1
Sequence:GTACCGGAGGACCTTTCCTTGCCCTTTGCTCGAGCAAAGGGCAAGGAAAGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-719s21c1
Sequence:CCGGGCCTTTGAGACTGTCCTGAAACTCGAGTTTCAGGACAGTCTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-698s21c1
Sequence:CCGGGACTCTACCAATGTTGAGCTACTCGAGTAGCTCAACATTGGTAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020387.2-400s21c1
Sequence:CCGGCGCTGCTGTCAAGGCTCAGATCTCGAGATCTGAGCCTTGACAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-453s21c1
Sequence:GTACCGGCCATCACCTCGGCGTACTATCCTCGAGGATAGTACGCCGAGGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-840s21c1
Sequence:GTACCGGAGAAGAGGGCCTGTTGCATCACTCGAGTGATGCAACAGGCCCTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020387.2-540s21c1
Sequence:GTACCGGGATGGCTGAAGGAGCTCTATGCTCGAGCATAGAGCTCCTTCAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016899
VALIDATED
RAB25 MISSION shRNA Bacterial Glycerol Stock
RAB25, member RAS oncogene family
Mouse
24 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-239s21c1
Sequence:GTACCGGTCTTTAAGGTGGTGCTGATCGCTCGAGCGATCAGCACCACCTTAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-706s21c1
Sequence:GTACCGGACTGTCCTCAAAGAGATCTTTCTCGAGAAAGATCTCTTTGAGGACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-671s1c1
Sequence:CCGGGCCCTCGACTCCACCAATGTTCTCGAGAACATTGGTGGAGTCGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-518s21c1
Sequence:CCGGGCTGGCTAAAGGAGCTGTATGCTCGAGCATACAGCTCCTTTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-712s1c1
Sequence:CCGGCCTCAAAGAGATCTTTGCAAACTCGAGTTTGCAAAGATCTCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-472s1c1
Sequence:CCGGCCTGGTATTTGACCTGACCAACTCGAGTTGGTCAGGTCAAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-235s1c1
Sequence:CCGGCTTTGTCTTTAAGGTGGTGCTCTCGAGAGCACCACCTTAAAGACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-872s1c1
Sequence:CCGGCCTGCCTTCAGCTTTCAGATACTCGAGTATCTGAAAGCTGAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-613s21c1
Sequence:GTACCGGACTGAGGAGGCCTGCATGTTTCTCGAGAAACATGCAGGCCTCCTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-507s21c1
Sequence:GTACCGGTGTGGTGGAGCGCTGGCTAAACTCGAGTTTAGCCAGCGCTCCACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-296s21c1
Sequence:GTACCGGGGTTCACCCGCAATGAGTTCACTCGAGTGAACTCATTGCGGGTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-484s21c1
Sequence:GTACCGGCTGACCAAGCACCAGACCTACCTCGAGGTAGGTCTGGTGCTTGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-842s21c1
Sequence:GTACCGGTCTGACTTCAGCTATGGCCAGCTCGAGCTGGCCATAGCTGAAGTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-541s21c1
Sequence:CCGGCATGCCGAAGCCACGATTGTTCTCGAGAACAATCGTGGCTTCGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-889s21c1
Sequence:CCGGATATCTCCACCTCCCTTACTGCTCGAGCAGTAAGGGAGGTGGAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-348s21c1
Sequence:CCGGGTTCTCCACCCGCACTGTAATCTCGAGATTACAGTGCGGGTGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-308s21c1
Sequence:CCGGATGAGTTCAGCCACGACAGTCCTCGAGGACTGTCGTGGCTGAACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-530s21c1
Sequence:GTACCGGAGCTGTATGACCATGCCGAAGCTCGAGCTTCGGCATGGTCATACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-718s21c1
Sequence:GTACCGGGAGATCTTTGCAAAGGTGTCCCTCGAGGGACACCTTTGCAAAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-831s21c1
Sequence:GTACCGGTTGCATCAGCCTCTGACTTCACTCGAGTGAAGTCAGAGGCTGATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-552s21c1
Sequence:GTACCGGCACGATTGTTGTCATGCTCGTCTCGAGACGAGCATGACAACAATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-417s21c1
Sequence:GTACCGGGGAGAGATACAGAGCCATCACCTCGAGGTGATGGCTCTGTATCTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-772s21c1
Sequence:GTACCGGATCACCCTGGGCAATGCCCAACTCGAGTTGGGCATTGCCCAGGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-669s21c1
Sequence:GTACCGGAGCCCTCGACTCCACCAATGTCTCGAGACATTGGTGGAGTCGAGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016899
VALIDATED
RAB25 MISSION shRNA shRNA Plasmid DNA
RAB25, member RAS oncogene family
Mouse
24 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-239s21c1
Sequence:GTACCGGTCTTTAAGGTGGTGCTGATCGCTCGAGCGATCAGCACCACCTTAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-706s21c1
Sequence:GTACCGGACTGTCCTCAAAGAGATCTTTCTCGAGAAAGATCTCTTTGAGGACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-671s1c1
Sequence:CCGGGCCCTCGACTCCACCAATGTTCTCGAGAACATTGGTGGAGTCGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-518s21c1
Sequence:CCGGGCTGGCTAAAGGAGCTGTATGCTCGAGCATACAGCTCCTTTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-712s1c1
Sequence:CCGGCCTCAAAGAGATCTTTGCAAACTCGAGTTTGCAAAGATCTCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-472s1c1
Sequence:CCGGCCTGGTATTTGACCTGACCAACTCGAGTTGGTCAGGTCAAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-235s1c1
Sequence:CCGGCTTTGTCTTTAAGGTGGTGCTCTCGAGAGCACCACCTTAAAGACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-872s1c1
Sequence:CCGGCCTGCCTTCAGCTTTCAGATACTCGAGTATCTGAAAGCTGAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-613s21c1
Sequence:GTACCGGACTGAGGAGGCCTGCATGTTTCTCGAGAAACATGCAGGCCTCCTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-507s21c1
Sequence:GTACCGGTGTGGTGGAGCGCTGGCTAAACTCGAGTTTAGCCAGCGCTCCACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-296s21c1
Sequence:GTACCGGGGTTCACCCGCAATGAGTTCACTCGAGTGAACTCATTGCGGGTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-484s21c1
Sequence:GTACCGGCTGACCAAGCACCAGACCTACCTCGAGGTAGGTCTGGTGCTTGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-842s21c1
Sequence:GTACCGGTCTGACTTCAGCTATGGCCAGCTCGAGCTGGCCATAGCTGAAGTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-541s21c1
Sequence:CCGGCATGCCGAAGCCACGATTGTTCTCGAGAACAATCGTGGCTTCGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-889s21c1
Sequence:CCGGATATCTCCACCTCCCTTACTGCTCGAGCAGTAAGGGAGGTGGAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-348s21c1
Sequence:CCGGGTTCTCCACCCGCACTGTAATCTCGAGATTACAGTGCGGGTGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-308s21c1
Sequence:CCGGATGAGTTCAGCCACGACAGTCCTCGAGGACTGTCGTGGCTGAACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-530s21c1
Sequence:GTACCGGAGCTGTATGACCATGCCGAAGCTCGAGCTTCGGCATGGTCATACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-718s21c1
Sequence:GTACCGGGAGATCTTTGCAAAGGTGTCCCTCGAGGGACACCTTTGCAAAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-831s21c1
Sequence:GTACCGGTTGCATCAGCCTCTGACTTCACTCGAGTGAAGTCAGAGGCTGATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-552s21c1
Sequence:GTACCGGCACGATTGTTGTCATGCTCGTCTCGAGACGAGCATGACAACAATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-417s21c1
Sequence:GTACCGGGGAGAGATACAGAGCCATCACCTCGAGGTGATGGCTCTGTATCTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-772s21c1
Sequence:GTACCGGATCACCCTGGGCAATGCCCAACTCGAGTTGGGCATTGCCCAGGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-669s21c1
Sequence:GTACCGGAGCCCTCGACTCCACCAATGTCTCGAGACATTGGTGGAGTCGAGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016899
VALIDATED
RAB25 MISSION shRNA Lentiviral Transduction Particles
RAB25, member RAS oncogene family
Mouse
24 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-239s21c1
Sequence:GTACCGGTCTTTAAGGTGGTGCTGATCGCTCGAGCGATCAGCACCACCTTAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-706s21c1
Sequence:GTACCGGACTGTCCTCAAAGAGATCTTTCTCGAGAAAGATCTCTTTGAGGACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-671s1c1
Sequence:CCGGGCCCTCGACTCCACCAATGTTCTCGAGAACATTGGTGGAGTCGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-518s21c1
Sequence:CCGGGCTGGCTAAAGGAGCTGTATGCTCGAGCATACAGCTCCTTTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-712s1c1
Sequence:CCGGCCTCAAAGAGATCTTTGCAAACTCGAGTTTGCAAAGATCTCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-472s1c1
Sequence:CCGGCCTGGTATTTGACCTGACCAACTCGAGTTGGTCAGGTCAAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016899.2-235s1c1
Sequence:CCGGCTTTGTCTTTAAGGTGGTGCTCTCGAGAGCACCACCTTAAAGACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016899.2-872s1c1
Sequence:CCGGCCTGCCTTCAGCTTTCAGATACTCGAGTATCTGAAAGCTGAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-613s21c1
Sequence:GTACCGGACTGAGGAGGCCTGCATGTTTCTCGAGAAACATGCAGGCCTCCTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-507s21c1
Sequence:GTACCGGTGTGGTGGAGCGCTGGCTAAACTCGAGTTTAGCCAGCGCTCCACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-296s21c1
Sequence:GTACCGGGGTTCACCCGCAATGAGTTCACTCGAGTGAACTCATTGCGGGTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-484s21c1
Sequence:GTACCGGCTGACCAAGCACCAGACCTACCTCGAGGTAGGTCTGGTGCTTGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-842s21c1
Sequence:GTACCGGTCTGACTTCAGCTATGGCCAGCTCGAGCTGGCCATAGCTGAAGTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-541s21c1
Sequence:CCGGCATGCCGAAGCCACGATTGTTCTCGAGAACAATCGTGGCTTCGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016899.4-889s21c1
Sequence:CCGGATATCTCCACCTCCCTTACTGCTCGAGCAGTAAGGGAGGTGGAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-348s21c1
Sequence:CCGGGTTCTCCACCCGCACTGTAATCTCGAGATTACAGTGCGGGTGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-308s21c1
Sequence:CCGGATGAGTTCAGCCACGACAGTCCTCGAGGACTGTCGTGGCTGAACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-530s21c1
Sequence:GTACCGGAGCTGTATGACCATGCCGAAGCTCGAGCTTCGGCATGGTCATACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-718s21c1
Sequence:GTACCGGGAGATCTTTGCAAAGGTGTCCCTCGAGGGACACCTTTGCAAAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-831s21c1
Sequence:GTACCGGTTGCATCAGCCTCTGACTTCACTCGAGTGAAGTCAGAGGCTGATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-552s21c1
Sequence:GTACCGGCACGATTGTTGTCATGCTCGTCTCGAGACGAGCATGACAACAATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-417s21c1
Sequence:GTACCGGGGAGAGATACAGAGCCATCACCTCGAGGTGATGGCTCTGTATCTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-772s21c1
Sequence:GTACCGGATCACCCTGGGCAATGCCCAACTCGAGTTGGGCATTGCCCAGGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016899.4-669s21c1
Sequence:GTACCGGAGCCCTCGACTCCACCAATGTCTCGAGACATTGGTGGAGTCGAGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)